We show the automation of human induced pluripotent stem cell (hiPSC) cultures and neuronal differentiations compatible with automated imaging and analysis.
Manual culture and differentiation protocols for human induced pluripotent stem cells (hiPSC) are difficult to standardize, show high variability and are prone to spontaneous differentiation into unwanted cell types. The methods are labor-intensive and are not easily amenable to large-scale experiments. To overcome these limitations, we developed an automated cell culture system coupled to a high-throughput imaging system and implemented protocols for maintaining multiple hiPSC lines in parallel and neuronal differentiation. We describe the automation of a short-term differentiation protocol using Neurogenin-2 (NGN2) over-expression to produce hiPSC-derived cortical neurons within 6‒8 days, and the implementation of a long-term differentiation protocol to generate hiPSC-derived midbrain dopaminergic (mDA) neurons within 65 days. Also, we applied the NGN2 approach to a small molecule-derived neural precursor cells (smNPC) transduced with GFP lentivirus and established a live-cell automated neurite outgrowth assay. We present an automated system with protocols suitable for routine hiPSC culture and differentiation into cortical and dopaminergic neurons. Our platform is suitable for long term hands-free culture and high-content/high-throughput hiPSC-based compound, RNAi and CRISPR/Cas9 screenings to identify novel disease mechanisms and drug targets.
Human induced pluripotent stem cells (hiPSC) are self-renewing and can differentiate in almost any adult cell type. These characteristics make hiPSC a useful tool for disease modeling in basic research and drug discovery1. Human iPSC retains the donor genetic background which allows deriving disease-relevant cell types that are most affected/involved in the disease course, for example, different neuronal subtypes for neurodegenerative diseases2,3. Also, hiPSC overcomes some of the limitations of animal and cellular over-expression models by modeling diseases in a human context and physiological protein expression levels, and have proven to be a valuable asset in modeling diseases ranging from monogenic, complex and epigenetic disorders as well as late-onset diseases4.
Despite these benefits and opportunities, several limitations of hiPSC still need to be addressed. Current hiPSC culture and differentiation protocols are not cost-effective, difficult to standardize and are labor-intensive. Manual culture steps can result in high variability in the yields and phenotypes due to differences in growth and spontaneous differentiation of hiPSC. Therefore, experimenter-dependent variation needs to be reduced by implementing more standardized handling techniques and simplifying protocols which can be achieved using automation5. The establishment of automated hiPSC culture and differentiation protocols will set common standards for both academic and industrial research projects, and allow the generation of biologically relevant disease models and more reproducible results.
Previous work has attempted automation of hiPSC cultures6,7,8 but their protocols have been restricted to specific cell culture plate formats dependent on the system and lacking adaptability to different assay formats. Such systems are useful in the bulking of cells but may not be suitable for automated differentiation into desired cell types, disease phenotyping, and screening purposes. Additionally, a large-scale automated platform for fibroblast derivation, hiPSC generation and differentiation has been described9 but on a scale that can only be achieved by high-throughput laboratories dedicated to the production of lines which seems attractive but can be unaffordable for many academic laboratories.
We developed a fully automated cell culture system based on a liquid handling station in a High-Efficiency Particulate Air (HEPA)-filtered environment in conjunction with a large-capacity CO2 incubator, a brightfield imaging cytometer and a robotic arm for plate transport. These components provide the basis for stable and reproducible hiPSC culture and differentiation. We complemented the system with an automated -20 °C storage system for compound or virus storage and a high-speed spinning disk confocal live-cell imager. Custom-made protocols were generated allowing automated cell seeding, media changes, confluency checks, cell expansion and assay plate generation with sample treatment and plate imaging, making the system compatible with high-content/high-throughput screenings. The automated cell culture and imaging system are operated using the controlling software and the custom-made graphical user interface (GUI). The GUI allows users to import CSV files containing cell line-specific parameters needed for method execution. Additionally, the GUI enables to schedule numerous experiments in any sequence using the built-in calendar view thus allowing full control of the time when each method starts.
Our automated cell culture system uses standardized pipetting speeds, passaging times, confluency thresholds, seeding densities, and medium volumes with the flexibility to culture cells in a variety of plate formats (96-, 48-, 24-, 12-, 6- or 1-well plate format). We adapted a recently published short-term differentiation protocol for converting hiPSC into neurons that can yield TUBB3 positive neurons in 6 days10,11. We also established the automated differentiation and imaging of small molecule neural precursor cells (smNPC) into neurons constitutively expressing GFP under EF1a promoter12 and iPSC into midbrain dopaminergic (mDA) neurons, adapting a previously published dual-SMAD inhibition protocol13 that yields mDA neurons within 65 days.
We introduce an automated cell culture system with integrated imaging capabilities for the standardization of hiPSC culture and neuronal differentiation. Due to minimal user intervention, experimental variation is low ensuring reproducibility of cellular phenotypes during differentiation. The calendar-based scheduler supports the organization and parallelization of experiments and allows a high degree of flexibility at which time the experiments are carried out. Existing methods can be easily adapted and the spectrum of available methods can be increased. Additionally, a large number of assay plate formats can be used adding to the flexibility of this system. The minimal system consisting of a CO2 incubator, a robotic arm, a brightfield cell cytometer, and a liquid handling station forms the basic unit needed for hiPSC culture and differentiation, with affordable costs to academic research laboratories. The combination of the automated cell culture system with an automated -20 °C storage system for storage of compounds, RNAi libraries or CRISPR/Cas9 libraries, and the integration of a high-content/high-throughput microscope enable the execution of phenotypic screenings.
In the current study, the automated cell culture system used disposable tips and the culture media was refilled manually into the reservoir, thus limiting the use of the liquid handling station for media changes and other culture processes especially overnight. To circumvent this limitation, the methods can be adjusted to needle usage instead of disposable tips and, after installing tube connections between media lines and media bags stored in a fridge, media reservoirs can be automatically refilled with fresh media pre-warmed by heater elements. This would reduce user interferences caused by manual refilling of tips, culture media and reservoir exchanges.
Our automated cell culture system offers several advantages. One is the barcode tracking system. The plates loaded in the system are identified by a unique barcode which is read and saved by the system allowing tracking of samples during and after method execution. Another advantage is the possibility to create user specific projects. Here, culture plates loaded in the system can be assigned to a specific project and grouped in batches. The structuring in batches simplifies the execution of the same procedure to all plates of a certain batch since no individual plates need to be selected. Additionally, a liquid class editor allows to adjust the pipetting speed and height as well as the aspiration and dispensing parameters for each liquid transfer step. Every process is documented in log files allowing to retrace which tasks have been performed for a given culture or assay plate.
Neurons and other cell types derived from human induced pluripotent stem cells (hiPSC) are useful in vitro tools for studying the mechanisms of neurodegenerative diseases in specific patient populations (e.g. dopaminergic neurons for Parkinson’s disease) offering the possibility for personalized drug screenings. Culturing hiPSC is very time intensive and demands trained people to execute complex differentiation protocols, usually limited to low scale production. We adapted the feeder-free culture of hiPSC to an automated culture and implemented two neuronal differentiation protocols, a rapid cortical neuron differentiation protocol based on NGN2 over-expression under a tet-on promoter10,11, and a long-term small molecule-based protocol for generation of midbrain dopaminergic (mDA) neurons13. The straightforward transfer and reproducibility of manual culture and differentiation protocols makes the automated culture system very useful. Human iPSC cultured in the automated cell culture system showed consistent stem cell morphology and expressed important pluripotency markers, reproducible between independent experiments. In addition, the automation of the hiPSC culture protocol favored the culture and expansion of a larger number of cell lines in parallel. Automated confluency checks scheduled to be performed overnight saved time leaving the system free during the day for downstream process steps carried out when the user was in the laboratory (e.g., harvesting of cells or manual replating for differentiations). On reaching the user-defined confluence threshold, cells are passaged and replated into extracellular matrix-coated plates available on the stacker of the automated cell culture system. Each passage round takes about 70 min and generates four 1-well plates from one parent plate, which translates to a capacity of 20 passages in a day.
The automation of the NGN2 differentiation protocol was done successfully and allowed the generation of a homogeneous population of neuronal cells across different passages and comparable to manual differentiations. Moreover, the experimental costs for large-scale screening studies involving multiple cell lines or screening experiments with thousands of test conditions/compounds would be reduced due to rapid differentiations. Cost-effective and high-throughput readouts including live-cell neurite outgrowth measurements can be easily developed, implemented and used as phenotypic readouts for disease modeling, as shown previously14,15,16. Thus, we further adapted the NGN2 protocol using small molecule derived neural precursor (smNPC) cells that constitutively over-express GFP. The smNPC cells offer further advantages including reduced costs with culture media (one third of the cost with iPSC culture) and time required to scale up experiments. The cell yields from smNPC are 7 to 10 times higher than that obtained with iPSC. The differentiating neurons were successfully monitored and imaged for several days using a fully automated imaging process without the need of manual antibody stainings or chemical labeling, saving costs and time required for manual procedures including the imaging by itself. The current imaging of inner 60 wells of a 96-well plate takes around 16 min per plate when 25 fields per well are imaged, which means that the data for an imaging-based screening for 1000 compounds, could be acquired and analyzed in a day. In the future, this readout could be used in compound screening studies for the rescue of neurite outgrowth defects.
Further, we also demonstrate the transfer of a manual differentiation protocol for generating midbrain dopaminergic (mDA) neurons from iPSC. This small molecule-based differentiation protocol takes 65 days and is labor intensive because of the multiple replating steps and frequent media changes, mostly every 2 days, which limits the production of mDA neurons to few iPSC lines at the same time. The automated mDA differentiation protocol has the great advantage of scaling up the differentiation to dozens of iPSC lines. Up to 30 cell lines could be differentiated in parallel. Since the differentiation is mostly based on media changes, almost the whole differentiation process can be conducted without human interference. Using the calendar-based scheduler of the automated system, we could plan the media changes according to the differentiation steps. One limitation of working with such a large number of cell lines and culture plates was the impossibility to perform overnight media changes. The main reason is the fact that our system is set up for using disposable tips and manual refilling of culture media requiring an user in the laboratory to execute this manual step. To facilitate the media change process, plates loaded in the system were assigned to a project and grouped in batches. The batch size was then adapted to the number of disposable tips and volume of culture media available. As discussed above, this limitation can be easily overcome by implementation of reusable/washable needles and automated refilling of media. Automated passaging/replating of cells, as shown for iPSC, is one of the conveniences offered by our automated cell culture system. We have tested the automated replating of mDA neurons on day 25 of differentiation. However, the dissociation of mDA neurons requires longer (40 min) incubation with the dissociation enzyme than iPSC (8 min) extending the automated replating process to more than 1 h per cell lines. As a consequence, the automated replating of 30 cell lines in the same day became impossible. Speeding up other steps during automated replating (transport of plates, pipetting) and adapting the system to the use of needles and media line that makes an overnight work possible would resolve this limitation. Despite the drawbacks, we could successfully transfer the manual protocol to an automated differentiation of mDA neurons producing cultures with substantial amounts of MAP2 (neuron) and TH (mDA neurons) positive cells.
Differentiating dozens of iPSC cell lines in parallel is of great interest in projects that investigate the molecular mechanisms of neurodegenerative diseases, including Parkinson’s disease. However, to complete tasks faster with fewer errors and at reduced costs is a big challenge. Due to the automation of the protocols presented here (iPSC, smNPC and mDA neuron), we could speed up, reduce the costs and increase reproducibility in our projects. The development of projects like FOUNDIN-PD (https://www.foundinpd.org/wp/) involving hundreds of patient cell lines shows need for automated culture and differentiation protocols. Our future perspectives include the transfer of manual 3 dimensional (3D) cell culture models to the automated system. Minor adaptations in the plate definition settings and the use of adaptors will allow the use of commercial or custom-made plates and microfluidic chambers required for the 3D cultures. Moreover, the implementation of an automated label-free imaging model will allow us to track the neuronal growth in real time and translate changes in neurite outgrowth, neuron organization and cell death into better understanding of the disease mechanisms.
The authors have nothing to disclose.
The authors gratefully acknowledge the patients and their families who contributed biomaterial for this study. Cells lines used in the study were from NINDS collection with Rutgers (ND41865 as iPS#1) and the lab of Dr. Tilo Kunath (iPS#2). This work is supported in part by the NOMIS Foundation (PH), RiMod-FTD, an EU Joint Programme – Neurodegenerative Disease Research (JPND) (PH); The DZNE I2A initiative (AD); PD-Strat, an ERA-Net ERACoSysMed funded project (PH) and the Foundational Data Initiative for Parkinson's Disease (FOUNDIN-PD) (PH, EB). FOUNDIN-PD is part of The Michael J. Fox Foundation’s PATH to PD program. The authors thank Steven Finkbeiner and Melanie Cobb (Gladstone Institutes) for contributing to the establishment of the manual mDA neuron differentiation protocol and Mahomi Suzuki (Yokogawa Electric Corporation) for assistance in neurite outgrowth analysis setup.
Antibodies | Distributor | Catalog Number | Dilution |
iPSC pluripotency marker | |||
Mouse anti-SSEA4 | Abcam | ab16287 | 1 to 33 |
Rabbit anti-Oct3/4 | Abcam | ab19857 | 1 to 200 |
NGN2 neuron markers | |||
Mouse anti- TUBB3 | R & D | MAB1195 | 1 to 500 |
Rabbit anti-BRN2 | NEB | 12137 | 1 to 1,000 |
mDA neuron markers | |||
Chicken anti-TH | Pel-Freez Biologicals | 12137 | 1 to 750 |
Mouse anti-MAP2 | Santa Cruz | sc-74421 | 1 to 750 |
Secondary antibodies | |||
Goat anti-chicken IgY, Alexa Fluor 488 | Invitrogen | A11039 | 1 to 2,000 |
Goat anti-mouse IgG, Alexa Fluor 488 | Invitrogen | A11029 | 1 to 2,000 |
Goat anti-mouse IgG, Alexa Fluor 594 | Invitrogen | A11032 | 1 to 2,000 |
Goat anti-rabbit IgG, Alexa Fluor 488 | Invitrogen | A11008 | 1 to 2,000 |
Goat anti-rabbit IgG, Alexa Fluor 488 | Invitrogen | A11008 | 1 to 2,000 |
Goat anti-rabbit IgG, Alexa Fluor 594 | Invitrogen | A11012 | 1 to 2,000 |
Nuclei counterstaining | |||
Hoechest 33342 | Invitrogen | H3570 | 1 to 8,000 |
Instruments | Distributor | Catalog Number | Description/Application |
Agilent TapeStation system | Agilent technologies | 4200 | Automated electrophoresis for DNA and RNA samples |
Automated -20 °C storage system | Hamilton Storage Technologies |
Sample Access Manager (SAM -20C, 3200 series) |
Storage of reagents |
Barcode reader | Honeywell | Barcode Reader Orbit | Barcode scanner |
Brightfield cell cytomat | Nexcelom | Celigo | Confluence check and cell counting |
CellVoyager 7000 | Yokogawa | CellVoyager 7000 | Automated confocal microscope |
Cytomat for cell cultures | Thermo Fisher Scientific | Cytomat 24 C, CU | 12 stackers pitch 28 mm, 12 stackers pitch 23 mm (total of 456 plates) |
Cytomat for thawing samples | Thermo Fisher Scientific | Cytomat 2-LIN, 60 DU (Drying Unit) |
2 stackers pitch 28 mm (total of 42 plates) |
HEPA filters | Hamilton Robotics | Hood Flow Star UV | Modified by Hamilton Robotics |
Liquid handling station | Hamilton Robotics | Microlab Star | Channels: 8x 1-ml, 4x 5 ml and 96 Channel MPH |
Media reservoir | Hamilton Robotics | 188211APE | Media/reagents reservoir |
Pure water system | Veolia Water | ELGA PURELAB Classic | Provides pure water for needle wash station |
QuantStudio 12K Flex Real-Time PCR System |
Thermo Fisher Scientific | QSTUDIO12KOA | Real-time PCR machine |
Robotic arm | Hamilton Robotics | Rackrunner | Transport of plates |
Turn table | Hamilton Robotics | Turn Table | Adjust plate orientiation |
Uninterruptible power supply | APC | Smart UPS RT Unit, 10000 VA Power supply |
Backup power supply |
VIAFLO-pipettes | Integra | 4500 | Electronic pipette |
ViiA 7 Real-Time PCR System | Applied Biosystems | 4453545 | Real-time PCR machine |
Materials | Distributor | Catalog Number | Notes |
1-well culture plate (84 cm2) | Thermo Fischer Scientific | 165218 | Nunc OmniTray |
6-well culture plates (9.6 cm2) | Greiner Bio-One | 657160 | TC treated with lid |
12-well culture plate (3.9 cm2) | Greiner Bio-One | 665180 | TC treated with lid |
96-well culture plate (0.32 cm2) | Perkin Elmer | 6005558 | CellCarrier-96 Black plate |
Tips, 50-µL | Hamilton Robotics | 235987 | 50-uL tips |
Tips, 300-µL | Hamilton Robotics | 235985 | 300-µL tips |
Tips, 1000-µL | Hamilton Robotics | 235939 | 1000-µL tips |
Tips, 5-mL | Hamilton Robotics | 184022 | 5-mL tips |
Tubes, 15-mL | Greiner Bio-One | 188271 | 15-mL tubes |
Tubes, 50-mL | Greiner Bio-One | 227261 | 50-mL tubes |
Nalgene cryogenic 2.0 mL vials | Sigma Aldrich | V5007 | Cryovials |
Plasmids | Distributor | Catalog Number | Notes |
pLV_hEF1a_rtTA3 | Addgene | 61472 | Kind gift from Ron Weiss |
pLV_TRET_hNgn2_UBC_Puro | Addgene | 61474 | Kind gift from Ron Weiss |
pLVX-EF1a-AcGFP1-N1 lentivirus | Takara Bio | 631983 | |
Primers | Sequence (forward) | Sequence (reverse) | Source |
iPSC pluripotency | |||
OCT4 (ID 4505967a1) | CTTGAATCCCGAATGGAAAGGG | GTGTATATCCCAGGGTGATCCTC | PrimerBank |
NANOG (ID 153945815c3) | CCCCAGCCTTTACTCTTCCTA | CCAGGTTGAATTGTTCCAGGTC | PrimerBank |
REX1 (ID 89179322c1) | AGAAACGGGCAAAGACAAGAC | GCTGACAGGTTCTATTTCCGC | PrimerBank |
NGN2 neurons | |||
MAP2 (ID 87578393c1) | CTCAGCACCGCTAACAGAGG | CATTGGCGCTTCGGACAAG | PrimerBank |
BRN2 (ID 380254475c1) | CGGCGGATCAAACTGGGATTT | TTGCGCTGCGATCTTGTCTAT | PrimerBank |
CUX2 (ID 291045458c2) | CGAGACCTCCACACTTCGTG | TGTTTTTCCGCCTCATTTCTCTG | PrimerBank |
NCAM1 (ID 336285437c3) | TGTCCGATTCATAGTCCTGTCC | CTCACAGCGATAAGTGCCCTC | PrimerBank |
SYNAPSIN1 (ID 91984783c3) | TGCTCAGCAGTACAACGTACC | GACACTTGCGATGTCCTGGAA | PrimerBank |
mDA neurons | |||
TH | CGGGCTTCTCGGACCAGGTGTA | CTCCTCGGCGGTGTACTCCACA | NCBI primer-BLAST |
MAP2 | GGATCAACGGAGAGCTGAC | TCAGGACTGCTACAGCCTCA | NCBI primer-BLAST |
Housekeeping genes | |||
GAPDH | GAAATCCCATCACCATCTTCCAGG | GAGCCCCAGCCTTCTCCATG | NCBI primer-BLAST |
OAZ1 | AGCAAGGACAGCTTTGCAGTT | ATGAAGACATGGTCGGCTCG | NCBI primer-BLAST |
RPLPO | CCTCATATCCGGGGGAATGTG | GCAGCAGCTGGCACCTTATTG | NCBI primer-BLAST |
RPL13A | GCCTACAAGAAAGTTTGCCTATC | TGGCTTTCTCTTTCCTCTTCTC | NCBI primer-BLAST |
Media and Reagents | Distributor | Catalog Number | Use concentration |
Coating matrix | |||
Extracellular matrix (Matrigel) | Corning | 354277 | 10 μg/mL |
Fibronectin | Corning | 356008 | 2 μg/mL |
Laminin | Sigma | L2020 | 5 – 10 μg/mL |
Poly-L-Ornithine (PLO) | Sigma | P3655 | 0.1 mg/mL |
Culture media | |||
iPSC culture medium (Essential 8 Flex medium) |
Gibco | A2858501 | |
NGN2 neurons – NGN2 medium | |||
2-mercaptoethanol | Gibco | 21985023 | 0.909 mL (50 µM) |
B27 supplement | Gibco | 12587010 | 10 mL (1%) |
DMEM/F-12, GlutaMAX | Gibco | 31331093 | 484.75 mL |
GlutaMAX | Gibco | 35050038 | 5 mL ( 2 mM) |
Insulin | Sigma | I9278 | 0.25 mL (2.5 µg/mL) |
MEM Non-Essential Amino Acids | Gibco | 11140050 | 5 mL (0.5%) |
N2 supplement | Gibco | 17502048 | 5 mL (0.5%) |
Neurobasal medium | Gibco | 21103049 | 485 mL |
mDA neurons – SRM medium | |||
2-mercaptoethanol | Gibco | 21985023 | 0.5 mL (55 µM) |
GlutaMAX | Gibco | 35050038 | 5 mL (2 mM) |
Knockout DMEM/F-12 | Gibco | 12660012 | 409.5 mL |
Knockout serum replacement (serum replacement) |
Gibco | 10828028 | 75 mL (15%) |
MEM Non-Essential Amino Acids | Gibco | 11140050 | 5 mL (1%) |
Penicillin-Streptomycin | Gibco | 15140122 | 5 mL (1%) |
mDA neurons – N2 medium | |||
B27 supplement | Gibco | 12587010 | 10 mL (2%) |
GlutaMAX | Gibco | 35050038 | 5 mL (2 mM) |
N2 supplement | Gibco | 17502048 | 5 mL (1%) |
Neurobasal medium | Gibco | 21103049 | 475 mL |
Penicillin-Streptomycin | Gibco | 15140122 | 5 mL(1%) |
mDA neurons – Differentiation medium | |||
B27 supplement | Gibco | 12587010 | 10 mL (2%) |
Neurobasal medium | Gibco | 21103049 | 485 mL |
Penicillin-Streptomycin | Gibco | 15140122 | 5 mL (1%) |
NGN2 neurons – Supplements | |||
Brain-Derived Neurotrophic Factor (BDNF) |
Peprotech | 450-02 | 10 ng/mL |
CHIR99021 (CHIR) | R&D | 4423/10 | 2 μM |
Doxycyline (dox) | Sigma | D9891 | 2.5 μg/mL |
Glial-Derived Neurotrophic Factor (GDNF) |
Peprotech | 450-10 | 10 ng/mL |
L-ascorbic acid 2-phosphate magnesium (AA2) |
Sigma | A8960 | 64 mg/L |
Neurotrophic factor-3 (NT-3) | Peprotech | 450-10 | 10 ng/mL |
Purmorphamine (PMA) | Cayman | 10009634 | 0.5 μM |
Puromycin | Sigma | P8833-10MG | 0.5 μg/mL |
Thiazovivin | Merk Millipore | 420220-10MG | 2 μM |
mDA neurons – Supplements | |||
Brain-Derived Neurotrophic Factor (BDNF) |
Peprotech | 450-02 | 20 ng/mL |
CHIR99021 (CHIR) | R&D | 4423/10 | 3 μM |
DAPT | Cayman | 13197 | 10 µM |
Dibutyryl-cAMP (db-cAMP) | Sigma | D0627 | 1 mM |
Fibroblast Growth Factor 8B (FGF-8b) | Peprotech | 100-25 | 100 ng/mL |
Glial-Derived Neurotrophic Factor (GDNF) |
Peprotech | 450-10 | 20 ng/mL |
L-ascorbic acid (AA1) | Sigma | A4403 | 0.2 mM |
LDN193189 (LDN) | Cayman | 11802 | 100 nM |
Purmorphamine (Purm) | Cayman | 10009634 | 2 μM |
Sonic Hedgehog/Shh (C24II) N-Terminus (SHH) |
R&D | 1845-SH | 100 ng/mL |
SB431542 (SB) | Cayman | 13031 | 10 μM |
Transforming Growth Factor type ß3 (TGFß3) |
R&D | 243-B3 | 1 ng/mL |
Y-27632 | Cayman | 10005583 | 10 µM |
Dissociation reagents | |||
Single cell dissociation reagent (StemPro Accutase) |
Gibco | A1110501 | 1x |
UltraPure 0.5M EDTA, pH 8.0 | Gibco | 11575020 | 0.5 mM |
RNA isolation and cDNA kit | |||
RNA isolation kit | Qiagen | 74106 | Rneasy MiniKit |
RNA lysis buffer | Thermo Fisher Scientific | 15596018 | Trizol lysis buffer (RNA lysis buffer) |
Reverse transcriptase (kit) | Thermo Fisher Scientific | 18080-085 | SuperScript III Reverse Transcriptase |
Software | Company | Catalog Number | Description/Application |
Cell Culture Framework (CCF) (Graphical user interface, GUI) |
Hamilton Robotics | Custom-made | User interface for the automated system |
CellPathFinder software (image analysis software 1) |
Yokogawa | CellPathfinder HCS Software | Image analysis tool |
CellVoyager Measurement System | Yokogawa | Included with CellVoyager 7000 |
Microscope controlling software |
Columbus software (image analysis software 2) |
Perkin Elmer | Columbus | Image analysis tool |
Cloud based qPCR app | Thermo Fisher Scientific | Themo Fisher cloud | Analysis software for qRT-PCR data |
Venus software | Hamilton Robotics | VENUS Two Dynamic Schedular 5.1 Software |
Controlling software for the automated system |