RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

Published: November 21, 2023

doi:

Long-xi Zhang, Qian-jin Dong, Shuai Yang, Wu-nan Che, Li-sheng Zhang, Jin-cheng Zhou², Hui Dong

¹College of Plant Protection,Shenyang Agricultural University, ²State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection,Chinese Academy of Agricultural Sciences

Summary

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Abstract

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Introduction

Trichogramma spp. are a group of egg parasitoids that have been extensively utilized as highly efficient biological control agents against a wide spectrum of lepidopteran pests in agricultural and forest ecosystems worldwide¹^,²^,³^,⁴. The application of mass-reared Trichogramma provides an environmentally friendly approach for the sustainable management of pests⁵^,⁶^,⁷. Understanding the molecular biology of Trichogramma wasps provides valuable insights into enhancing the mass-rearing efficiency and field performance of these biological control agents⁸^,⁹by investigating the methodology of gene regulation and genome editing¹⁰.

Since the discovery of double-stranded RNA (dsRNA)-mediated specific genetic interference in Caenorhabditis elegans in 1998, the RNA-interference (RNAi) method has evolved into a vital genetic toolkit for exploring the regulatory mechanisms of organisms by suppressing the expression of target genes¹¹. RNAi experiments have become a standard methodology widely applied to study gene function in numerous insect species¹²^,¹³. Nevertheless, the manipulation of RNAi presents a formidable challenge in many parasitoid species, particularly among those belonging to the endoparasitic Chalcidoidea family¹⁴^,¹⁵^,¹⁶. The RNAi method has been documented in at least 13 parasitoid species¹⁴^,¹⁵^,¹⁶^,¹⁷^,¹⁸^,¹⁹. Among these, the RNAi approach has been comprehensively conducted in Nasonia wasps and is applicable throughout the developmental stages, including embryos, larvae, pupae, and adults¹⁴^,¹⁵^,¹⁶. It is noteworthy that Nasonia wasps are ectoparasitoids, with their offspring developing in the interstitial space between the host pupa and the puparium, enabling their cultivation in vitro and making them tolerate certain treatments, such as micro-injection. Unlike Nasonia wasps, Trichogramma individuals undergo their entire embryonic, larval, and pupal development inner the host egg. The layer at embryo and larva stages (which may impede dsRNA permeability), vulnerability to damage, and the difficulty in surviving in vitro present formidable obstacles²⁰^,²¹^,²². Additionally, the diminutive size of Trichogramma individuals, approximately ~0.5 mm in adult or pupal length, renders them exceedingly intricate to manipulate²⁰^,²¹^,²².

In the present study, we outline a comprehensive procedure for conducting RNA interference (RNAi) experiments in Trichogramma denrolimi Matsumura. This procedure encompasses the following procedures: (1) the design and synthesis of double-stranded RNA (dsRNA), (2) microinjection of T. denrolimi pupae, (3) the transplantation and in vitro incubation of these pupae, and (4) the detection of target gene knockdown through RT-qPCR analysis. The target gene selected for the RNAi experiment is the ferritin heavy chain homology (Ferhch). FerHCH, an iron-binding protein, contains a ferroxidase center endowed with antioxidant capabilities, facilitating the oxidation of Fe²⁺ to Fe³⁺. It plays an indispensable role in the growth and development of various organisms by maintaining redox equilibrium and iron homeostasis. Depletion of FerHCH can result in the overaccumulation of iron, leading to irreversible tissue damage, and often culminating in significant phenotypic alterations, including growth defects, deformities, and mortality²³^,²⁴. This study offers a step-by-step guide for conducting RNAi in T. denrolimi, which will be invaluable for investigating the gene functions within the broader context of Trichogramma wasps.

Protocol

NOTE: See the Table of Materials for details related to all materials, instruments, software, and reagents used in this protocol. 1. Collection and maintenance of insect culture Adhere a group of ~5,000 eggs of Corcyra cephalonica (Stainton) onto a 9 cm by 16 cm card using a 1:5 (v/v) solution of gum arabic powder and water25,26. NOTE: Avoid attaching too many host eggs to t…

Representative Results

The emergence rate of T. denrolimi pupae injected with dsFerhch was significantly lower than that of those injected with dsGFP or those without injection (Table 1). Among the emerged wasps, 51.85% of T. denrolimi wasps subjected to dsFerhch developed deformed small wings. The deformed wasps were not observed in the wasps injected with dsGFP or without any injection (Table 1). Moreover, the abdomens of T. denrolimi pupae injec…

Discussion

Trichogramma wasps are recognized as effective biological control agents, specifically targeting a range of lepidopteran pests in agriculture and forestry¹. These diminutive wasps undergo their immature stages within the host egg, a characteristic that presents challenges in conducting RNAi experiments⁵^,¹⁸. This study offers a comprehensive visual guide for conducting RNAi experiments in T. denrolimi. Given the shared bio…

Disclosures

The authors have nothing to disclose.

Acknowledgements

This research was funded by the Projects of the National Natural Science Foundation of China (32172476, 32102275), the Agricultural Science and Technology Innovation Program (CAAS-ZDRW202203, CAAS-ZDRW202108), and Central Funds Guiding the Local Science and Technology Development (XZ202301YD0042C).

Materials

2x ES Taq MasterMix (Dye)	Cowin Biotech, China	CW0690H	To amplify the dsRNA sequences
20x PBS Buffer, DEPC treated (7.2-7.6)	Sangon Biotech, China	B540627-0500	To dilute dsRNA
Agar strip	Shishi Globe Agar Industries Co.,Ltd, China	n/a	To make culture medium
Ampicillin sodium	Sangon Biotech, China	A610028	To make culture medium
Bioer Constant temperature metal bath	BIOER, China	MB-102	To synthesis dsRNA
Borosilicate glass capillary	WPI, USA	1B100-4	To pull capillary glass needle
Clean bench	Airtech, China	SW-CJ-1FD	To extract RNA
Double distilled water	Sangon Biotech, China	A500197-0500	To dilute cDNA
Environmental Testing chamber	Panasonic, Japan	MLR-352H-PC	To culture T. denrolimi
Eppendorf Centrifuge	Eppendrof, Germany	5418R	To store RNA content
Eppendorf FemtoJet 4i	Eppendrof, Germany	FemtoJet 4i	To inject T. denrolimi
Eppendorf Refrigerated Centrifuge	Eppendrof, Germany	5810R	Centrifuge
Ethanol solution (75%, RNase-free)	Aladdin, China	M052131-500ml	To extract RNA
Gel Extraction Kit	Omega, USA	D25000-02	To extract cDNA
GUM Arabic	Solarbio, China	CG5991-500g	To make egg card
Isopropyl alchohol	Aladdin, China	80109218	To extract RNA
Laser-Based Micropipette Puller	SUTTER, USA	P-2000	To pull capillary glass needle
Microloader	Eppendrof, Germany	20 µL	To load dsRNA
Multi-sample tissue grinder	LICHEN, China	LC-TG-24	To grind T. denrolimi
Needle Grinder	SUTTER, USA	BV-10-E	To grind capillary glass needle
Nuclease-Free Water	Sangon Biotech, China		To dilute RNA
OLYMPUS Microscope	OLYMPUS, Japan	XZX16	To observe T. denrolimi
PCR machine	Bio-rad, USA	S-1000	For DNA amplification
PowerPac Basic	Bio-rad, USA	PowerPacTM Basic	To detect the quality of dsRNA
Primer of dsGFP (Forward)			[TAATACGACTCACTATAGGG] ACAAACCAAGGCAAGTAATA
Primer of dsGFP (Reverse)			[TAATACGACTCACTATAGGG] CAGAGGCATCTTCAACG
Primer of Ferhch for qPCR (Forward)			TGAAGAGATTCTGCGTTCTGCT
Primer of Ferhch for qPCR (Reverse)			CTGTAGGAACATCAGCAGGCTT
Primer of Ferhch for RNAi (Reverse)			[TAATACGACTCACTATAGGG]AG TAGCCATCATCTTTCC
Primer of Ferhch for RNAi(Forward)			[TAATACGACTCACTATAGGG] ACACTGTCAATCGTCCTG
Primer of FoxO for qPCR (Forward)			CTACGCCGATCTCATAACGC
Primer of FoxO for qPCR (Reverse)			TGCTGTCGCCCTTGTCCT
PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time)	TaKaRa, Japan	RR047A
Quantitative Real-time PCR	Bio-rad, USA	CFX 96 Touch	To perform reverse transcriptase polymerase chain reaction (RT-PCR)
Real-time PCR (TaqMan) Primer and Probes Design Tool			https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool/
T7 RiBoMAX Express RNAi System	Promega, USA	P1700	To synthesis dsRNA in vitro
TB Green Premix Ex TaqTM (Til RnaseH Plus)	TaKaRa, Japan	RR820A	To perform RT-qPCR
Trichloromethane	KESHI, China	GB/T682-2002	To extract RNA
TRIzol Reagent	Ambion, USA	15596018	To extract total RNA content from samples
Ultra-low Temperature Freezer	Thermo, USA	Forma 911

References

Zang, L. S., Wang, S., Zhang, F., Desneux, N. Biological control with Trichogramma in China: History, present status and perspectives. Annu Rev Entomol. 66, 463-484 (2020).
Zhou, J. C., et al. Optimal clutch size for quality control of bisexual and Wolbachia-infected thelytokous lines of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) mass reared on eggs of a substitutive host, Antheraea pernyi Guérin-Méneville (Lepidoptera: Saturniidae). Pest Manag Sci. 76 (8), 2635-2644 (2020).
Li, T. H., et al. Current status of the biological control of the fall armyworm Spodoptera frugiperda by egg parasitoids. J Pest Sci. 96, 1345-1363 (2023).
Zhou, J. C., et al. Effects of temperature and superparasitism on quality and characteristics of thelytokous Wolbachia-infected Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) during mass rearing. Sci Rep. 9 (1), 18114 (2019).
Zhou, J. C., et al. Penetrance during Wolbachia-mediated parthenogenesis of Trichogramma wasps is reduced by continuous oviposition, associated with exhaustion of Wolbachia titers in ovary and offspring eggs. Pest Manag Sci. 78 (7), 3080-3089 (2022).
Huang, N. X., et al. Long-term and large-scale releases of Trichogramma promote pesticide decrease in maize in northeastern China. Entomol Gen. 40 (4), 331-335 (2020).
Wang, P., et al. Performance of Trichogramma japonicum as a vector of Beauveria bassiana for parasitizing eggs of rice striped stem borer, Chilo suppressalis. Entomol Gen. 41 (2), 147-155 (2021).
Ning, S. F., et al. The identification and expression pattern of the sex determination genes and their sex-specific variants in the egg parasitoid Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae). Front Physiol. 14, 1243753 (2023).
Huo, L. X., et al. Selection and evaluation of RT-qPCR reference genes for expression analysis in the tiny egg parasitoid wasp, Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae). J Asia Pac Entomol. 25 (2), 101883 (2022).
Leung, K., et al. Next-generation biological control: the need for integrating genetics and genomics. Biol Rev Camb Philos Soc. 95 (6), 1838-1854 (2020).
Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391 (6669), 806-811 (1998).
Leonard, S. P., et al. Engineered symbionts activate honey bee immunity and limit pathogens. Science. 367 (6477), 573-576 (2020).
Sun, Y., et al. Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants. Plant Biotechnol J. 17 (5), 852-854 (2019).
Li, M., Bui, M., Akbari, O. S. Embryo Microinjection and Transplantation Technique for Nasonia vitripennis Genome Manipulation. J Vis Exp. 130, e56990 (2017).
Dalla Benetta, E., Chaverra-Rodriguez, D., Rasgon, J. L., Akbari, O. S. Pupal and Adult Injections for RNAi and CRISPR Gene Editing in Nasonia vitripennis. J Vis Exp. 166, e61892 (2020).
Lynch, J. A., Desplan, C. A method for parental RNA interference in the wasp Nasonia vitripennis. Nat Protoc. 1 (1), 486-494 (2006).
Zhu, K. Y., Palli, S. R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu Rev Entomol. 65, 293-311 (2020).
Colinet, D., et al. Development of RNAi in a Drosophila endoparasitoid wasp and demonstration of its efficiency in impairing venom protein production. J Insect Physiol. 63, 56-61 (2014).
Wang, B., et al. A digestive tract expressing α-amylase influences the adult lifespan of Pteromalus puparum revealed through RNAi and rescue analyses. Pest Manag Sci. 75 (12), 3346-3355 (2019).
Zhou, J. C., et al. Wolbachia-infected Trichogramma dendrolimi is outcompeted by its uninfected counterpart in superparasitism but does not have developmental delay. Pest Manag Sci. 79 (3), 1005-1017 (2023).
Zhou, J. C., et al. Posterior concentration of Wolbachia during the early embryogenesis of the host dynamically shapes the tissue tropism of Wolbachia in host Trichogramma wasps. Front Cell Infect Microbiol. 13, 1198428 (2023).
Lee, T. Y. The development of Trichogramma evanescens Westw. and its influence on the embryonic development of its host, Attacus cynthia ricini Boisd. Acta Entomol Sin Z. 11 (1), 89-119 (1961).
Shen, Y., Chen, Y. Z., Zhang, C. X. RNAi-mediated silencing of genes in the brown planthopper Nilaparvata lugens affects survival, growth and female fecundity. Pest Manag Sci. 77 (1), 365-377 (2021).
Wu, S., Yin, S., Zhou, B. Molecular physiology of iron trafficking in Drosophila melanogaster. Curr Res Insect Sci. 50, 100888 (2022).
Zhou, J. C., et al. Wolbachia-Driven Memory Loss in a Parasitic Wasp Increases Superparasitism to Enhance Horizontal Transmission. mBio. 13 (6), e0236222 (2022).
Ning, S. F., Zhou, J. C., Liu, Q. Q., Zhao, Q., Dong, H. Gradual, temperature-induced change of secondary sexual characteristics in Trichogramma pretiosum infected with parthenogenesis-inducing Wolbachia. PeerJ. 7, e7567 (2019).
Zhang, C., et al. Decreased Wolbachia titers cause gradual change in masculinization of intersex individuals of thelytokous Trichogramma dendrolimi. Entomol Gen. 42 (5), 751-759 (2022).
Zhang, X., et al. Multi-parasitism: A promising approach to simultaneously produce Trichogramma chilonis and T. dendrolimi on eggs of Antheraea pernyi. Entomol Gen. 41 (6), 627-636 (2021).
Zhou, J. C., et al. Effects of Thelytokous parthenogenesis-inducing Wolbachia on the fitness of Trichogramma dendrolimi Matsumura (Hymenoptera: Trichogrammatidae) in superparasitised and single-parasitised hosts. Front Ecol Evol. 9, 730664 (2021).
Flanders, S. E. Notes on the life history and anatomy of Trichogramma. Ann Entomol Soc Am. 30 (2), 304-308 (1937).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Cite This Article

Zhang, L., Dong, Q., Yang, S., Che, W., Zhang, L., Zhou, J., Dong, H. RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura. J. Vis. Exp. (201), e66250, doi:10.3791/66250 (2023).