This protocol describes the isolation of mouse endothelial cells from whole pancreas.
The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and glucagon, as well as digestive enzymes. The pancreas is also a highly vascularized organ, a feature facilitated by the intricate network of pancreatic capillaries. This extensive capillary network is made up of highly fenestrated endothelial cells (ECs) important for pancreas development and function. Accordingly, the dysfunction of ECs can contribute to that of the pancreas in diseases like diabetes and cancer. Thus, researching the function of pancreatic ECs (pECs) is important not only for understanding pancreas biology but also for developing its pathologies. Mouse models are valuable tools to study metabolic and cardiovascular diseases. However, there has not been an established protocol with sufficient details described for the isolation of mouse pECs due to the relatively small population of ECs and the abundant digestive enzymes potentially released from the acinar tissue that can lead to cell damage and, thus, low yield. To address these challenges, we devised a protocol to enrich and recover mouse pECs, combining gentle physical and chemical dissociation and antibody-mediated selection. The protocol presented here provides a robust method to extract intact and viable ECs from the whole mouse pancreas. This protocol is suitable for multiple downstream assays and may be applied to various mouse models.
The pancreas, key to metabolic control and homeostasis, is a highly vascularized organ. The pancreas has both endocrine and exocrine functions, controlling the regulation of blood glucose and digestive enzymes, respectively. These two compartments are linked together by the extensive network of pancreatic blood vessels, facilitating the exchange and transport of oxygen, hormones, and enzymes. Critically, this dense capillary network penetrates the Islet of Langerhans, a cluster of hormone-regulating cells within the pancreas responsible for its endocrine function, consisting of the glucagon-secreting alpha (α) cells, the insulin-secreting beta (β) cells and the somatostatin-secreting delta (δ) cells1,2. Although the islets only make up 1-2% of the pancreatic mass, they receive 20% of total blood flow3, highlighting the importance of islet vasculature. The pancreatic capillaries are primarily made up of highly fenestrated endothelial cells (ECs), which are surrounded by mural pericytes. These capillary ECs play a vital role in the islet development, maturation, and (dys)function and form intimate crosstalks with various endo- and exocrine cells4 (Figure 1).
Endothelial dysfunction has been observed in both Type 1 and Type 2 diabetes, the most common conditions caused by pancreatic islet dysfunction5,6. Both islet microvascular density and morphology can be altered in diabetes7. Moreover, pancreatic cancer, a highly aggressive tumor that can also be manifested as diabetes, is characterized by high microvascular density with poor perfusion8. Given the pivotal structural and functional roles of ECs in both normal and diseased pancreatic tissue, there is a pertinent need to study the pECs in development, physiology, and pathology to unveil the mechanisms that drive health or diseases.
Numerous protocols have been developed for the isolation of ECs from different murine (e.g., brain9,10, lung11, heart12, liver13, skeletal muscles14, and adipose tissues15) and human (e.g., brain16, visceral adipose tissue17,18, peripheral nerves19, lung20,21,22, and mesenteric artery23) tissues. These protocols typically involve the use of enzymatic digestions (e.g., by collagenase, trypsin24, dispase24,25, and liberase26), followed by an antibody-based enrichment step. Moreover, these protocols tend to rely on extended durations of digestions in high concentrations of enzymes with vigorous agitation at 37 °C (Table 1). Due to the unique features of the pancreas, including that it houses a plethora of endogenous digestive enzymes, these existing protocols cannot be directly applied to isolate pECs. First, the extracellular matrix (ECM) composition of the pancreas is different from other tissues. While collagenase is commonly used for EC isolation, there are multiple subtypes with different tissue-specific dissociation capabilities, thus requiring optimization. Second, and crucial to pEC isolation, the release and activation of pancreatic endogenous enzymes can significantly hinder the isolation process. To this end, caution needs to be taken to minimize the rupture of the exocrine acinar cells (the primary source of zymogens, proteases, and RNase27), which can induce further cell damage and result in low cell viability and overall affect recovery27,28,29.
To address these challenges, we have adapted methods from existing EC isolation protocols and established a new protocol suitable for EC isolation from mouse pancreases. Specifically, we describe here a workflow (Figure 2) using collagenase Type I (typically implemented for lung EC isolation), lower digestion temperatures and no agitation (to prevent activation of pancreatic zymogens), and DNase30,31,32 supplementation (to prevent DNA-induced apoptosis and improve cell viability, and an antibody for CD3133 (PECAM1, a pan-EC marker). The described protocol produces EC populations isolated from mouse pancreas that can be used for gene expression profiling and protein assays.
Tissue isolation was performed under the approved study protocol #17010 by the Institutional Animal Care and Use Committee (IACUC) of Beckman Research Institute, City of Hope (Duarte, California, USA). Here, we use Tie-2CreERT2;Rosa26-TdTomato mouse line in C57BL/6 background at 8 – 12 weeks of age. In this line, ECs are labeled with TdTomato when induced with tamoxifen as previously described34. However, this protocol can be adapted for all ages of adult mice with different genotypes and genetic backgrounds.
1. Tissue collection (estimated time: 1-2 h)
NOTE: The time estimate is 15 min/animal, recommended maximum 3 animals pooled per dissociation samples.
2. Collagenase preparation (estimated time: 15-30 min)
3. Digestion (estimated time: 40 min-1 h)
4. Endothelial cell (EC) enrichment (estimated time: 2-3 h)
5. Culturing pECs
Following this protocol, approximately 2 x 106 live cells can be obtained when pooling 3 mouse pancreases, and 750,000 cells from a single mouse pancreas. To validate the enrichment of EC, we performed the following analyses: 1) quantitative PCR: compared to the flow-through (FT) samples (i.e., the non-CD31 antibody-bound fractions), the EC fractions had significantly higher levels of Pecam1 (encoding CD31) and Kdr (encoding VEGFR2), two EC marker genes33, and lower levels of NK6 homeobox 1 (Nkx6.1), a transcription factor in the pancreatic endocrine cells (Figure 4A); 2) western blotting: EC-enriched samples from three preparations (pEC-1-3) showed strong signals of CD31 at the expected size (~130 kDa). In comparison, the input and FT samples showed minimal CD31 signal. As a positive control, lysates of MS1 cells, a pEC cell line, also showed strong CD31 signal (Figure 4B); 3) trypan blue staining: we found the viability of isolated cells was around 50% (Figure 4C); 4) flow cytometry following a published protocol15 : through gating on the live cell population (Figure 4D), we found the CD31+ cells were at 88% and the TdTomato+ cells were at 76%. Of note, the majority of isolated cells co-express CD31 and TdTomato (Figure 4E). As negative controls, the unstained MS1 cells and MS1 incubated with IgG showed no live cells as marked by CD31. As the positive control, i.e., MS1 cells stained for CD31 showed close to 100% live CD31+ cells (Figure 4F). We also cultured the isolated cells, performed immunofluorescence staining of PECAM1 following a published protocol36, and imaged TdTomato, which showed robust signals of both markers in the isolated cells, suggesting the presence of ECs (Figure 4G).
Figure 1: Illustration of vascularization of pancreas and pancreatic islets. A pictorial depiction of the pancreatic endothelial cells (ECs) and intra-islet ECs. Please click here to view a larger version of this figure.
Figure 2: Overview of workflow. 1) Pancreas dissection, 2) mechanical digestion, 3) enzyme incubation, 4) centrifugation, 5a) supernatant removal and 5b) secondary Collagenase digestion of the cell pellets with trituration for filtering in 6), 7), and 8) pellet reconstitution and antibody binding, 9) microbeads incubation, 10) MACS column enrichment, 11) cell counting for viability, and 12) downstream analysis. Please click here to view a larger version of this figure.
Figure 3: Tissue processing steps. Images of (A) the abdominal cavity, (B) the isolated mouse pancreas, and (C) the trimmed mouse pancreas. Please click here to view a larger version of this figure.
Figure 4: Validation of isolated EC fractions from mouse pancreas. (A) qPCR of FT samples and enriched EC fraction with CD31 for enrichment. Pecam1 (CD31), Kdr (VEGFR2), and Nkx6.1 (pancreatic β-cell specific transcription factor)33. * denotes p <0.05 compared to FT based on t tests. n = 3-4 pooled samples, consisting of 3 mice each. (B) Western blotting of CD31. pEC-1-3 indicate enriched ECs from 3 separate pooled mouse samples. Cell lysates of 30 mg was loaded onto each lane, followed by Ponceau S staining. (C) Cell counting and trypan blue staining of enriched pECs for viability assay. (D) Flow cytometry gating strategy for mouse pECs stained by 4', 6-diamidino-2-phenylindole (DAPI) and CD31 antibody. (E) Flow cytometry histograms of unstained MS1 (top left), MS1 stained with AlexaFluor-488 secondary antibody (IgG control; top right), MS1 stained with CD31 (bottom left), and the isolated mouse pECs stained with CD31 (bottom right). (F) Percentage of live cells quantified using flow cytometry. (G) Immunofluorescence of CD31 expression (green) with DAPI (blue) counterstain and endogenous TdTomato fluorescent reporter (red). Scale bar = 100 µm. Please click here to view a larger version of this figure.
Figure 5: CD31 and CD144 specificity in mouse pancreas. (A) Immunofluorescence of mouse pancreas with CD31 (Magenta) and CD144 (Cyan), with DAPI counterstain. Image captured using a 10x lens under a widefield fluorescent inverted microscope. Scale bar = 100 µm. Dashed lines demarcate islet area. (B) Uniform Manifold Approximation and Projection (UMAP) showing Cdh5 and Pecam1 expression in the islet ECs from C57BL6 mice detected by scRNA-seq (GSE128565)37. Please click here to view a larger version of this figure.
Enzyme | Use | Temperature and Time | Reference |
Collagenase I | Single cell dissociation, whole pancreas EC enrichment | 37 °C, 20 min | This protocol |
Collagenase IV | Islet Isolation and and non-enzymatic dissociation | 37 °C, 20 min | 46 |
Collagenase + Trypsin | Examining ductal cells in mouse pancreas | 37 °C, 30 min | 47 |
Collagenase B | Single cell suspension of pancreas | 37 °C, 30 min | 48 |
Collagenase NBI | Islet Isolation | 37 °C, 30 min | 49 |
Collagenase P | Acinar viable suspension | 37 °C, 15 min | 45 |
Collagenase XI | Islet Isolation | 37 °C, 15 min | 35 |
Dispase | Single cell suspension | 37 °C, 45 min | 24 |
Liberase | Single cell suspension | 37 °C, 10 min | 25, 48 |
Trypsin | Single cell dissociation, whole pancreas | 4 °C, O/N | 28 |
Table 1: Summary of various protocols used to process mouse pancreas samples.
In this article, we present a protocol for enrichment and isolation of the pECs. Similar to previous EC isolation protocols from other tissues or organs, this protocol consists of three major processes, namely, physical dissociation, enzymatic digestion, and antibody-based EC enrichment. To address the unique challenges in processing the pancreas, we introduced several key adaptations and critical steps within our protocol: 1) a gentle one-step collagenase digestion with a short incubation time, 2) supplementation of higher concentration of DNase and a trypsin inhibitor to minimize DNA contamination and endogenous enzyme digestion, which can interfere with antibody binding and thus diminish EC enrichment and viability and 3) cell counting after the digestion step to adjust how much antibody is added to the sample to optimize EC enrichment. In the process of optimizing this protocol, we tested other enzymes used in previous studies, e.g., trypsin28, collagenase Type IV31, and other digestion temperatures, e.g. 4°C, as well as different incubation times (Table 1). We found collagenase Type I, 20 min, at 37 °C to be the optimal condition for the mouse pEC isolation and used this here. While the addition of an anticoagulant during the perfusion may improve overall cell viability, typical anticoagulating agent, e.g., EDTA or Heparin may interfere with the activity of certain enzymes, e.g., collagenase for cell dissociation and reverse transcriptase used in qPCR. To prevent the unexpected/undesirable effect of these anticoagulants, PBS (without Ca2+ and Mg2+) for perfusion is used.
We focused on developing a protocol for enriching EC population from whole mouse pancreases, which would include both intra-islet ECs and ECs in the exocrine tissues, resulting in a higher yield. In the current protocol, we pooled together 3 animals during the dissociation step and on average achieved a single-cell suspension with approximately 2.0 x 106 viable cells. We have also tested samples from single mouse pancreas and about 750,000 cells can be obtained. It is worth noting that when adjusting to process a single animal, less dissociation solution (3 mL dissociation per pancreas) should be used. A crucial step in the protocol is to completely trim and remove any residual fat that is attached to the pancreas (Figure 3B). Adipose tissue contamination in the collagenase digestion will interfere with the pancreatic single cell dissociation step diminishing cell viability in the subsequent enrichment steps38. Moreover, to enrich pECs we used a pan-EC surface marker, PECAM1/CD31. Using PECAM1/CD31 antibody, we were able to significantly enrich EC fractions, evident by the gene expression analysis. In the development of this protocol, we had also tested the utility of CD144 antibody, which has also been commonly used to isolate ECs13. However, we were not able to enrich pECs (data not shown). Intriguingly, immunofluorescent staining revealed that whereas CD31 is expressed in all ECs in the pancreas tissue, CD144 antibody appears to stain only intra-islet ECs (Figure 5A). Additionally, we analyzed publicly available single cell RNA-seq data from islets isolated from C57BL/6 mice (GSE128565)37 and found that approximately 50% of the islet ECs show expression of both Cdh5 (VE-Cad) and Pecam1, but the rest of islet ECs express only Cdh5 or Pecam1 (Figure 5B). Thus, we speculate that CD31 antibodies is more appropriate for pEC isolation and the utility of CD144 antibody for this purpose warrants future investigation. Moreover, there are commercially available anti-CD31 conjugated with magnetic beads which can simplify the two-step antibody binding step to a singular step.
As demonstrated, we performed qPCR, immunoblotting, flow cytometry, and immunofluorescent staining to validate the isolated EC fraction. It is conceivable that these fractions can be subjected to other assays, such as (sc)RNA-seq and mass spectrometry. A limitation of this protocol is that we have not been able to achieve robust subculture and perform functional assays. Given that subculture of isolated mouse ECs has been shown to be challenging, this is an area warranting future efforts. One way to address this may be the introduction of large T antigen, which has been used to immortalize primary cells39.
The recent advances and application of scRNA sequencing have enabled high-resolution profiling of pancreatic cells40 and especially islet cells41. However, most of the existing studies have focused on endocrine cell populations and used tissue dissociation protocols that does not efficiently retain ECs. As a result, EC fractions often end up scarce, constituting only 3%-5% in the entire captured cell populations42,43,44. A recent protocol uses two-step enzymatic digestion and deactivation and a fluorescently activated cell sorting step and retrieves ECs at 12% of the entire pancreatic cell population45. Complementary to this protocol, our protocol provides a simplified workflow, which may be more cost-effective and less technically demanding should ECs be the focus of the study. Although this protocol has only been tested in mouse pancreas, it can be scaled up and adapted to isolate ECs from other organisms, including human pancreas.
The authors have nothing to disclose.
The authors thank Dr. Brian Armstrong at City of Hope, and Mindy Rodriguez at University of California, Riverside for technical assistance. This study was funded in part by grants from the NIH (R01 HL145170 to ZBC), Ella Fitzgerald Foundation (to ZBC), City of Hope (Arthur Riggs Diabetes Metabolism and Research Institute Innovation Award), and California Institute of Regenerative Medicine grant EDU4-12772 (to AT). Research reported in this publication included work performed in the Light Microscopy and Digital Imaging supported by the National Cancer Institute of the NIH under award number P30CA033572. Figure 1 and Figure 2 were made with BioRender.
1.5 mL eppendorf | USA Scientific | 1615-5500 | |
10 cm dish | Genesee Scientific | 25-202 | |
25G needles | BD | 305145 | |
2X Taq Pro Universal SYBR qPCR Master Mix | Vazyme | Q712-03-AA | |
5 mL eppendorf | Thermo Fisher | 14282300 | |
6-well plate | Greiner Bio-One | 07-000-208 | |
70 µm strainer | Fisher | 22-363-548 | |
Anti-CD31-biotin | Miltenyi Biotech | REA784 | |
Bovine serum albumin heat shock treated | Fisher | BP1600-100 | |
CaCl2 | Fisher | BP510 | |
Centrifuge | Eppendorf | ||
Collagen Type 1, from calf skin | Sigma Aldrich | C9791 | Attachment reagent in the protocol |
Collagenase Type 1 | Worthington Bio | LS004197 | |
Countess Automatic Cell Counter | Thermo Fisher | ||
DAPI | Thermo Fisher | D1306 | immunofluorescence |
Disposable Safety Scalpels | Myco Instrumentation | 6008TR-10 | |
DNAse I | Roche | 260913 | |
D-PBS (Ca2+,Mg2+) | Thermo Fisher | 14080055 | |
Ethanol | Fisher | BP2818-4 | |
Fetal bovine serum | Fisher | 10437028 | |
Incubator | Kept at 37 °C 5% CO2 | ||
LS Columns | Miltenyi Biotech | 130-042-401 | |
M199 | Sigma | M2520-1L | |
MACS MultiStand with the QuadroMACS Separator | Miltenyi Biotech | 130-042-303 | |
Medium 199 | Sigma Aldrich | M2520-10X | |
Microbeads anti-biotin | Miltenyi Biotech | 130-090-485 | |
Microscope | Leica | To assess cell morphology | |
Molecular Grade Water | Corning | 46-000-CM | |
NaCl | Fisher | S271-1 | |
New Brunswick Innova 44/44R Orbital shaker | Eppendorf | ||
PECAM1 (CD31) Antibody | Abcam | ab56299 | immunofluorescence |
PECAM1 (CD31) Antibody | R&D Systems | AF3628 | |
Phosphate Buffered Saline (10X) (no Ca2+,no Mg2+) | Genesee Scientific | 25-507-XB | |
Primer 36B4 Forward mouse | IDT | AGATTCGGGATATGCTGTTGGC | |
Primer 36B4 Revese mouse | IDT | TCGGGTCCTAGACCAGTGTTC | |
Primer Kdr Forward mouse | IDT | TCCAGAATCCTCTTCCATGC | |
Primer Kdr Reverse mouse | IDT | AAACCTCCTGCAAGCAAATG | |
Primer Nkx6.1 Reverse mouse | IDT | CACGGCGGACTCTGCATCACTC | |
Primer Nxk6.1 Forward mouse | IDT | CTCTACTTTAGCCCCAGCG | |
Primer PECAM1 Forward mouse | IDT | ACGCTGGTGCTCTATGCAAG | |
Primer PECAM1 Reverse mouse | IDT | TCAGTTGCTGCCCATTCATCA | |
RNase ZAP | Thermo Fisher | AM9780 | |
RNase-free water | Takara | RR036B | |
Sterile 12" long forceps | F.S.T | 91100-16 | |
Sterile fine forceps | F.S.T | 11050-10 | |
Sterile fine scissors | F.S.T | 14061-11 | |
Tissue Culture Dishes 2cm | Genesee Scientific | 25-260 | |
TRIzol reagent | Fisher | 15596018 | |
Trypan Blue | Corning | MT25900CI | |
Trypsin Inhibitor | Roche | 10109886001 | |
Tween-20 | |||
VE-Cadherin Antibody | Abcam | ab33168 | immunofluorescence |
Waterbath |
.