Isolation of Mouse Pancreatic Endothelial Cells
Summary
This protocol describes the isolation of mouse endothelial cells from whole pancreas.
Abstract
The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and glucagon, as well as digestive enzymes. The pancreas is also a highly vascularized organ, a feature facilitated by the intricate network of pancreatic capillaries. This extensive capillary network is made up of highly fenestrated endothelial cells (ECs) important for pancreas development and function. Accordingly, the dysfunction of ECs can contribute to that of the pancreas in diseases like diabetes and cancer. Thus, researching the function of pancreatic ECs (pECs) is important not only for understanding pancreas biology but also for developing its pathologies. Mouse models are valuable tools to study metabolic and cardiovascular diseases. However, there has not been an established protocol with sufficient details described for the isolation of mouse pECs due to the relatively small population of ECs and the abundant digestive enzymes potentially released from the acinar tissue that can lead to cell damage and, thus, low yield. To address these challenges, we devised a protocol to enrich and recover mouse pECs, combining gentle physical and chemical dissociation and antibody-mediated selection. The protocol presented here provides a robust method to extract intact and viable ECs from the whole mouse pancreas. This protocol is suitable for multiple downstream assays and may be applied to various mouse models.
Introduction
The pancreas, key to metabolic control and homeostasis, is a highly vascularized organ. The pancreas has both endocrine and exocrine functions, controlling the regulation of blood glucose and digestive enzymes, respectively. These two compartments are linked together by the extensive network of pancreatic blood vessels, facilitating the exchange and transport of oxygen, hormones, and enzymes. Critically, this dense capillary network penetrates the Islet of Langerhans, a cluster of hormone-regulating cells within the pancreas responsible for its endocrine function, consisting of the glucagon-secreting alpha (α) cells, the insulin-secreting beta (β) cells and the somatostatin-secreting delta (δ) cells1,2. Although the islets only make up 1-2% of the pancreatic mass, they receive 20% of total blood flow3, highlighting the importance of islet vasculature. The pancreatic capillaries are primarily made up of highly fenestrated endothelial cells (ECs), which are surrounded by mural pericytes. These capillary ECs play a vital role in the islet development, maturation, and (dys)function and form intimate crosstalks with various endo- and exocrine cells4 (Figure 1).
Endothelial dysfunction has been observed in both Type 1 and Type 2 diabetes, the most common conditions caused by pancreatic islet dysfunction5,6. Both islet microvascular density and morphology can be altered in diabetes7. Moreover, pancreatic cancer, a highly aggressive tumor that can also be manifested as diabetes, is characterized by high microvascular density with poor perfusion8. Given the pivotal structural and functional roles of ECs in both normal and diseased pancreatic tissue, there is a pertinent need to study the pECs in development, physiology, and pathology to unveil the mechanisms that drive health or diseases.
Numerous protocols have been developed for the isolation of ECs from different murine (e.g., brain9,10, lung11, heart12, liver13, skeletal muscles14, and adipose tissues15) and human (e.g., brain16, visceral adipose tissue17,18, peripheral nerves19, lung20,21,22, and mesenteric artery23) tissues. These protocols typically involve the use of enzymatic digestions (e.g., by collagenase, trypsin24, dispase24,25, and liberase26), followed by an antibody-based enrichment step. Moreover, these protocols tend to rely on extended durations of digestions in high concentrations of enzymes with vigorous agitation at 37 °C (Table 1). Due to the unique features of the pancreas, including that it houses a plethora of endogenous digestive enzymes, these existing protocols cannot be directly applied to isolate pECs. First, the extracellular matrix (ECM) composition of the pancreas is different from other tissues. While collagenase is commonly used for EC isolation, there are multiple subtypes with different tissue-specific dissociation capabilities, thus requiring optimization. Second, and crucial to pEC isolation, the release and activation of pancreatic endogenous enzymes can significantly hinder the isolation process. To this end, caution needs to be taken to minimize the rupture of the exocrine acinar cells (the primary source of zymogens, proteases, and RNase27), which can induce further cell damage and result in low cell viability and overall affect recovery27,28,29.
To address these challenges, we have adapted methods from existing EC isolation protocols and established a new protocol suitable for EC isolation from mouse pancreases. Specifically, we describe here a workflow (Figure 2) using collagenase Type I (typically implemented for lung EC isolation), lower digestion temperatures and no agitation (to prevent activation of pancreatic zymogens), and DNase30,31,32 supplementation (to prevent DNA-induced apoptosis and improve cell viability, and an antibody for CD3133 (PECAM1, a pan-EC marker). The described protocol produces EC populations isolated from mouse pancreas that can be used for gene expression profiling and protein assays.
Protocol
Representative Results
Discussion
In this article, we present a protocol for enrichment and isolation of the pECs. Similar to previous EC isolation protocols from other tissues or organs, this protocol consists of three major processes, namely, physical dissociation, enzymatic digestion, and antibody-based EC enrichment. To address the unique challenges in processing the pancreas, we introduced several key adaptations and critical steps within our protocol: 1) a gentle one-step collagenase digestion with a short incubation time, 2) supplementation of hig…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
The authors thank Dr. Brian Armstrong at City of Hope, and Mindy Rodriguez at University of California, Riverside for technical assistance. This study was funded in part by grants from the NIH (R01 HL145170 to ZBC), Ella Fitzgerald Foundation (to ZBC), City of Hope (Arthur Riggs Diabetes Metabolism and Research Institute Innovation Award), and California Institute of Regenerative Medicine grant EDU4-12772 (to AT). Research reported in this publication included work performed in the Light Microscopy and Digital Imaging supported by the National Cancer Institute of the NIH under award number P30CA033572. Figure 1 and Figure 2 were made with BioRender.
Materials
| 1.5 mL eppendorf | USA Scientific | 1615-5500 | |
| 10 cm dish | Genesee Scientific | 25-202 | |
| 25G needles | BD | 305145 | |
| 2X Taq Pro Universal SYBR qPCR Master Mix | Vazyme | Q712-03-AA | |
| 5 mL eppendorf | Thermo Fisher | 14282300 | |
| 6-well plate | Greiner Bio-One | 07-000-208 | |
| 70 µm strainer | Fisher | 22-363-548 | |
| Anti-CD31-biotin | Miltenyi Biotech | REA784 | |
| Bovine serum albumin heat shock treated | Fisher | BP1600-100 | |
| CaCl2 | Fisher | BP510 | |
| Centrifuge | Eppendorf | ||
| Collagen Type 1, from calf skin | Sigma Aldrich | C9791 | Attachment reagent in the protocol |
| Collagenase Type 1 | Worthington Bio | LS004197 | |
| Countess Automatic Cell Counter | Thermo Fisher | ||
| DAPI | Thermo Fisher | D1306 | immunofluorescence |
| Disposable Safety Scalpels | Myco Instrumentation | 6008TR-10 | |
| DNAse I | Roche | 260913 | |
| D-PBS (Ca2+,Mg2+) | Thermo Fisher | 14080055 | |
| Ethanol | Fisher | BP2818-4 | |
| Fetal bovine serum | Fisher | 10437028 | |
| Incubator | Kept at 37 °C 5% CO2 | ||
| LS Columns | Miltenyi Biotech | 130-042-401 | |
| M199 | Sigma | M2520-1L | |
| MACS MultiStand with the QuadroMACS Separator | Miltenyi Biotech | 130-042-303 | |
| Medium 199 | Sigma Aldrich | M2520-10X | |
| Microbeads anti-biotin | Miltenyi Biotech | 130-090-485 | |
| Microscope | Leica | To assess cell morphology | |
| Molecular Grade Water | Corning | 46-000-CM | |
| NaCl | Fisher | S271-1 | |
| New Brunswick Innova 44/44R Orbital shaker | Eppendorf | ||
| PECAM1 (CD31) Antibody | Abcam | ab56299 | immunofluorescence |
| PECAM1 (CD31) Antibody | R&D Systems | AF3628 | |
| Phosphate Buffered Saline (10X) (no Ca2+,no Mg2+) | Genesee Scientific | 25-507-XB | |
| Primer 36B4 Forward mouse | IDT | AGATTCGGGATATGCTGTTGGC | |
| Primer 36B4 Revese mouse | IDT | TCGGGTCCTAGACCAGTGTTC | |
| Primer Kdr Forward mouse | IDT | TCCAGAATCCTCTTCCATGC | |
| Primer Kdr Reverse mouse | IDT | AAACCTCCTGCAAGCAAATG | |
| Primer Nkx6.1 Reverse mouse | IDT | CACGGCGGACTCTGCATCACTC | |
| Primer Nxk6.1 Forward mouse | IDT | CTCTACTTTAGCCCCAGCG | |
| Primer PECAM1 Forward mouse | IDT | ACGCTGGTGCTCTATGCAAG | |
| Primer PECAM1 Reverse mouse | IDT | TCAGTTGCTGCCCATTCATCA | |
| RNase ZAP | Thermo Fisher | AM9780 | |
| RNase-free water | Takara | RR036B | |
| Sterile 12" long forceps | F.S.T | 91100-16 | |
| Sterile fine forceps | F.S.T | 11050-10 | |
| Sterile fine scissors | F.S.T | 14061-11 | |
| Tissue Culture Dishes 2cm | Genesee Scientific | 25-260 | |
| TRIzol reagent | Fisher | 15596018 | |
| Trypan Blue | Corning | MT25900CI | |
| Trypsin Inhibitor | Roche | 10109886001 | |
| Tween-20 | |||
| VE-Cadherin Antibody | Abcam | ab33168 | immunofluorescence |
| Waterbath |
Referenzen
- Ballian, N., Brunicardi, F. C. Islet vasculature as a regulator of endocrine pancreas function. World J Surg. 31 (4), 705-714 (2007).
- Almaca, J., Weitz, J., Rodriguez-Diaz, R., Pereira, E., Caicedo, A. The pericyte of the pancreatic islet regulates capillary diameter and local blood flow. Cell Metab. 27 (3), 630-644 (2018).
- Lifson, N., Lassa, C. V., Dixit, P. K. Relation between blood flow and morphology in islet organ of rat pancreas. Am J Physiol. 249 (1 Pt 1), E43-E48 (1985).
- Burganova, G., Bridges, C., Thorn, P., Landsman, L. The role of vascular cells in pancreatic beta-cell function. Front Endocrinol (Lausanne). 12, 667170 (2021).
- Hadi, H. A., Suwaidi, J. A. Endothelial dysfunction in diabetes mellitus. Vasc Health Risk Manag. 3 (6), 853-876 (2007).
- Granlund, L., Hedin, A., Korsgren, O., Skog, O., Lundberg, M. Altered microvasculature in pancreatic islets from subjects with type 1 diabetes. PLoS One. 17 (10), e0276942 (2022).
- Dai, C., et al. Pancreatic islet vasculature adapts to insulin resistance through dilation and not angiogenesis. Diabetes. 62 (12), 4144-4153 (2013).
- Nishikawa, Y., Tsuji, Y., Isoda, H., Kodama, Y., Chiba, T. Perfusion in the tissue surrounding pancreatic cancer and the patient’s prognosis. Biomed Res Int. 2014, 648021 (2014).
- Conchinha, N. V., et al. Protocols for endothelial cell isolation from mouse tissues: Brain, choroid, lung, and muscle. STAR Protoc. 2 (3), 100508 (2021).
- Ruck, T., Bittner, S., Epping, L., Herrmann, A. M., Meuth, S. G. Isolation of primary murine brain microvascular endothelial cells. J Vis Exp. (93), e52204 (2014).
- Wang, J., Niu, N., Xu, S., Jin, Z. G. A simple protocol for isolating mouse lung endothelial cells. Sci Rep. 9 (1), 1458 (2019).
- Sokol, L., et al. Protocols for endothelial cell isolation from mouse tissues: Small intestine, colon, heart, and liver. STAR Protoc. 2 (2), 100489 (2021).
- Guo, Q., Furuta, K., Aly, A., Ibrahim, S. H. Isolation and characterization of mouse primary liver sinusoidal endothelial cells. J Vis Exp. (178), e63062 (2021).
- Ieronimakis, N., Balasundaram, G., Reyes, M. Direct isolation, culture and transplant of mouse skeletal muscle derived endothelial cells with angiogenic potential. PLoS One. 3 (3), e0001753 (2008).
- Tang, X., et al. Suppression of endothelial ago1 promotes adipose tissue browning and improves metabolic dysfunction. Circulation. 142 (4), 365-379 (2020).
- Navone, S. E., et al. Isolation and expansion of human and mouse brain microvascular endothelial cells. Nat Protoc. 8 (9), 1680-1693 (2013).
- Chaurasiya, V., et al. Human visceral adipose tissue microvascular endothelial cell isolation and establishment of co-culture with white adipocytes to analyze cell-cell communication. Exp Cell Res. 433 (2), 113819 (2023).
- Villaret, A., et al. Adipose tissue endothelial cells from obese human subjects: Differences among depots in angiogenic, metabolic, and inflammatory gene expression and cellular senescence. Diabetes. 59 (11), 2755-2763 (2010).
- Domer, P., et al. Rapid and efficient immunomagnetic isolation of endothelial cells from human peripheral nerves. Sci Rep. 11 (1), 1951 (2021).
- Comhair, S. A., et al. Human primary lung endothelial cells in culture. Am J Respir Cell Mol Biol. 46 (6), 723-730 (2012).
- Hewett, P. W., Murray, J. C. Human lung microvessel endothelial cells: Isolation, culture, and characterization. Microvasc Res. 46 (1), 89-102 (1993).
- Gaskill, C., Majka, S. M. A high-yield isolation and enrichment strategy for human lung microvascular endothelial cells. Pulm Circ. 7 (1), 108-116 (2017).
- Malhi, N. K., et al. Isolation and profiling of human primary mesenteric arterial endothelial cells at the transcriptome level. J Vis Exp. (181), 63307 (2022).
- Reichard, A., Asosingh, K. Best practices for preparing a single cell suspension from solid tissues for flow cytometry. Cytometry A. 95 (2), 219-226 (2019).
- Brandhorst, H., et al. Large-scale comparison of liberase hi and collagenase nb1 utilized for human islet isolation. Cell Transplant. 19 (1), 3-8 (2010).
- Waise, S., et al. An optimised tissue disaggregation and data processing pipeline for characterising fibroblast phenotypes using single-cell rna sequencing. Sci Rep. 9 (1), 9580 (2019).
- Amsterdam, A., Jamieson, J. D. Studies on dispersed pancreatic exocrine cells. I. Dissociation technique and morphologic characteristics of separated cells. J Cell Biol. 63 (3), 1037-1056 (1974).
- Li, D., et al. Complete disassociation of adult pancreas into viable single cells through cold trypsin-edta digestion. J Zhejiang Univ Sci B. 14 (7), 596-603 (2013).
- Ji, B., Gaiser, S., Chen, X., Ernst, S. A., Logsdon, C. D. Intracellular trypsin induces pancreatic acinar cell death but not nf-kappab activation. J Biol Chem. 284 (26), 17488-17498 (2009).
- Mao, X., et al. Single-cell transcriptomic analysis of the mouse pancreas: Characteristic features of pancreatic ductal cells in chronic pancreatitis. Genes (Basel). 13 (6), 1015 (2022).
- Lee, H., Engin, F. Preparing highly viable single-cell suspensions from mouse pancreatic islets for single-cell rna sequencing. STAR Protoc. 1 (3), 100144 (2020).
- Schlesinger, Y., et al. Single-cell transcriptomes of pancreatic preinvasive lesions and cancer reveal acinar metaplastic cells’ heterogeneity. Nat Commun. 11 (1), 4516 (2020).
- Park, S., Dimaio, T. A., Scheef, E. A., Sorenson, C. M., Sheibani, N. Pecam-1 regulates proangiogenic properties of endothelial cells through modulation of cell-cell and cell-matrix interactions. Am J Physiol Cell Physiol. 299 (6), C1468-C1484 (2010).
- Kim, Y. W., et al. Integration of single-cell transcriptomes and biological function reveals distinct behavioral patterns in bone marrow endothelium. Nat Commun. 13 (1), 7235 (2022).
- Li, D. S., Yuan, Y. H., Tu, H. J., Liang, Q. L., Dai, L. J. A protocol for islet isolation from mouse pancreas. Nat Protoc. 4 (11), 1649-1652 (2009).
- Malhi, N. K., et al. Serine-arginine-rich protein kinase-1 inhibition for the treatment of diabetic retinopathy. Am J Physiol Heart Circ Physiol. 322 (6), H1014-H1027 (2022).
- Sachs, S., et al. Targeted pharmacological therapy restores beta-cell function for diabetes remission. Nat Metab. 2 (2), 192-209 (2020).
- Seaman, S. A., Tannan, S. C., Cao, Y., Peirce, S. M., Lin, K. Y. Differential effects of processing time and duration of collagenase digestion on human and murine fat grafts. Plast Reconstr Surg. 136 (2), 189e-199e (2015).
- Arbiser, J. L., et al. Oncogenic h-ras stimulates tumor angiogenesis by two distinct pathways. Proc Natl Acad Sci U S A. 94 (3), 861-866 (1997).
- Muraro, M. J., et al. A single-cell transcriptome atlas of the human pancreas. Cell Syst. 3 (4), 385-394 (2016).
- Segerstolpe, A., et al. Single-cell transcriptome profiling of human pancreatic islets in health and type 2 diabetes. Cell Metab. 24 (4), 593-607 (2016).
- Kang, R. B., et al. Single-nucleus rna sequencing of human pancreatic islets identifies novel gene sets and distinguishes beta-cell subpopulations with dynamic transcriptome profiles. Genome Med. 15 (1), 30 (2023).
- Lawlor, N., et al. Single-cell transcriptomes identify human islet cell signatures and reveal cell-type-specific expression changes in type 2 diabetes. Genome Res. 27 (2), 208-222 (2017).
- Fasolino, M., et al. Single-cell multi-omics analysis of human pancreatic islets reveals novel cellular states in type 1 diabetes. Nat Metab. 4 (2), 284-299 (2022).
- Yosefov-Levi, O., Tornovsky, S., Parnas, O. Pancreatic tissue dissection to isolate viable single cells. J Vis Exp. (195), e64871 (2023).
- Castillo, J. J., et al. Islet amyloid polypeptide aggregation exerts cytotoxic and proinflammatory effects on the islet vasculature in mice. Diabetologia. 65 (10), 1687-1700 (2022).
- Tremblay, J. R., et al. Rare, tightly-bound, multi-cellular clusters in the pancreatic ducts of adult mice function like progenitor cells and survive and proliferate after acinar cell injury. Stem Cells. 42 (4), 385-401 (2024).
- Zook, H. N., et al. Activation of ductal progenitor-like cells from adult human pancreas requires extracellular matrix protein signaling. iScience. 27 (3), 109237 (2024).
- Sordi, V., et al. Establishment, characterization and long-term culture of human endocrine pancreas-derived microvascular endothelial cells. Cytotherapy. 19 (1), 141-152 (2017).
.