Transfecting Primary Macrophages with Modified mRNA

Published: April 30, 2024

Abstract

Source: Herb, M. et al., Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA. J. Vis. Exp. (2019)

This video demonstrates the process of transfecting primary macrophages with modified mRNA encoding green fluorescent protein. These modified mRNAs, designed to reduce immunogenicity and improve its stability, ensure the successful transfection and subsequent expression of green fluorescent proteins, which is confirmed through fluorescence microscopy.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board. NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or an RNAse-degrading surfactant (Table of Materials). Ensure that all…

Offenlegungen

The authors have nothing to disclose.

Materials

5-methyl-CTP (100 mM) Jena Biosience NU-1138S stored at -20 °C
Antarctic phosphatase New England BioLabs M0289 stored at -20 °C
Antarctic phosphatase reaction buffer (10X) New England BioLabs B0289 stored at -20 °C
anti-NEMO/IKKγ antibody Invitrogen MA1-41046 stored at -20 °C
anti-β-actin antibody Sigma-Aldrich A2228 stored at -20 °C
Petri dishes 92,16 mm with cams Sarstedt 8,21,473 stored at RT
CD11b Microbeads mouse and human Miltenyi Biotec 130-049-601 stored at 4 °C
Cre recombinase + T7-Promotor forward primer Sigma-Aldrich 5′-GAAATTAATACGACTCACTATA
GGGGCAGCCGCCACCATGTCC
AATTTACTGACCGTAC-3', stored at -20 °C
Cre recombinase + T7-Promotor reverse primer Sigma-Aldrich 5′-CTAATCGCCATCTTCCAGCAGG
C-3′, stored at -20 °C
DNA purification kit: QIAquick PCR purification Kit Qiagen 28104 stored at RT
eGFP + T7-Promotor forward primer Sigma-Aldrich 5´-GAAATTAATACGACTCACTATA
GGGATCCATCGCCACCATGGTG
AGCAAGG-3´, stored at -20 °C
eGFP + T7-Promotor reverse primer Sigma-Aldrich 5´-TGGTATGGCTGATTA
TGATCTAGAGTCG-3´, stored at -20 °C
Fast Digest buffer (10X) Thermo Scientific B64 stored at -20 °C
FastDigest XbaI Thermo Scientific FD0684 stored at -20 °C
High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase New England Biolabs Inc M0491S stored at -20 °C
IKKβ + T7-Promotor forward primer Sigma-Aldrich 5′-GAAATTAATACGACTCACTATA
GGGTTGATCTACCATGGACTACA
AAGACG-3′, stored at -20 °C
IKKβ + T7-Promotor reverse primer Sigma-Aldrich 5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C
in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing) New England BioLabs E2060 stored at -20 °C
LS Columns Miltenyi Biotec 130-042-401 stored at RT
MACS MultiStand Miltenyi Biotec 130-042-303 stored at RT
mRNA transfection buffer and reagent: jetMESSENGER Polyplus transfection 409-0001DE stored at 4 °C
Mutant IKKβ IKK-2S177/181E plasmid Addgene 11105 stored at -20 °C
Mutant NEMOC54/347A plasmid Addgene 27268 stored at -20 °C
pEGFP-N3 plasmid Addgene 62043 stored at -20 °C
Poly(I:C) Calbiochem 528906 stored at -20 °C
pPGK-Cre plasmid F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C
Pseudo-UTP (100 mM) Jena Biosience NU-1139S stored at -20 °C
QuadroMACS Separator Miltenyi Biotec 130-090-976 stored at RT
Rat-anti-mouse CD11b antibody, APC-conjugated BioLegend 101212 stored at 4 °C
Rat-anti-mouse F4/80 antibody, PE-conjugated eBioscience 12-4801-82 stored at 4 °C
recombinant M-CSF Peprotech 315-02 stored at -20 °C
RNA purification kit: MEGAclear transcription clean-up kit ThermoFisher Scientific AM1908 stored at 4 °C
RNAse-degrading surfactant: RnaseZAP Sigma-Aldrich R2020 stored at RT
Ultrapure LPS from E.coli O111:B4 Invivogen stored at -20 °C
Wild type IKKβ plasmid Addgene 11103 stored at -20 °C
Wild type NEMO plasmid Addgene 27268 stored at -20 °C

Tags

Play Video

Diesen Artikel zitieren
Transfecting Primary Macrophages with Modified mRNA. J. Vis. Exp. (Pending Publication), e22224, doi: (2024).

View Video