TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Summary

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Abstract

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Introduction

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications – DNA methylation and histone modification – underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.

To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)¹. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq — chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA — we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.

Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26^{CAG floxed-pA H2B-FLAG}). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2a^H2B-FLAG)¹. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons¹.

Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

Protocol

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations. 1. Tissue dissection Dissect the tissues of interest into small pieces (approximately <3 mm2) using fine spring scissors. Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results. Add the dissected tissue fragmen…

Representative Results

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio…

Discussion

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.

A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<…

Materials

Protein LoBind tube, 2 mL	Eppendorf	No. 0030108132	For cell lysis
Protein LoBind tube, 1.5 mL	Eppendorf	No. 0030108116	For ChIP and library preparation
DNA LoBind tube, 1.5 mL	Eppendorf	No. 0030108051	For ChIP and library preparation
8-strip PCR tube	BIO-BIK	3247-00	For ChIP and library preparation
SK Mill	TOKKEN	SK-200	Handy cryogenic grinder to make cell powder for fixation
Metal bullet	TOKKEN	SK-100-DLC10	Accessory of SK Mill
2 mL stainless steel tube	TOKKEN	TK-AM5-SUS	An option for cell lysis
2 mL stainless steel tube holder	TOKKEN	SK-100-TL	An option for cell lysis
16% formaldehyde (w/v), methanol-free	Pierce	28906	To fix cells. Prepare 1% solution before use.
Glycine	Nacalai Tesque	17109-35	Prepare 2.5 M stock
D-PBS (-)(1x)	Nacalai Tesque	14249-24	For washing lysate and purified DNA
HEPES	Nacalai Tesque	02443-05	For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.
5 M NaCl, molecular biology grade	Nacalai Tesque	06900-14	For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
0.5 M EDTA, molecular biology grade	Wako Pure Chemical Industries, Ltd.	311-90075	For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
Glycerol	Wako Pure Chemical Industries, Ltd.	072-04945	For lysis buffer 1
NP-40	Nacalai Tesque	25223-75	For lysis buffer 1
Triton X-100, molecular biology grade	Nacalai Tesque	12967-32	For Lysis buffer 1
Tris	Nacalai Tesque	35406-91	For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.
0.1 M EGTA pH neutral	Nacalai Tesque	08947-35	For Lysis Buffer 2
Protease inhibitor cocktail (100x)	Nacalai Tesque	25955-24	To block degradation of protein
RIPA buffer	Thermo Fisher Scientific	89900	For cell lysis and washing
milliTUBE 1 mL AFA Fiber	Covaris	520130	Sonicator tube. Accessory of Focused-ultrasonicator
Focused-ultrasonicator	Covaris	S220 or E220	To digest DNA into adequate size for ChIP-Seq
UltraPure 10% SDS	Thermo Fisher Scientific	15553-027	For ChIP Elution Buffer
RNase A	Nacalai Tesque	30141-14	To purify DNA from lysate
Proteinase K, recombinant, PCR Grade	Sigma-Aldrich	3115887001	To purify DNA from lysate
Ethanol	Wako Pure Chemical Industries, Ltd.	054-07225	Make 70% solution
Monoclonal anti-FLAG M2 antibody produced in mouse	Sigma-Aldrich	F1804	To purify chromatin expressed in cells of interest
Dynabead M-280 Sheep Anti-Mouse IgG	Thermo Fisher Scientific	11201D	This can be used for anti-FLAG IP and anti-H3K4me3 IP
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody	Wako Pure Chemical Industries, Ltd.	301-34811	Any other antibody that works for ChIP analysis will work
10x Blocking Reagent	Sigma-Aldrich	11096176001	For blocking during affinity purification
Denhardt’s solution	Nacalai Tesque	10727-74	For blocking during affinity purification
Glycogen (5 mg/ml)	Thermo Fisher Scientific	AM9510	To purify DNA from lysate
Qubit 2.0 Fluorometer	Thermo Fisher Scientific	Q32866	For quantification of isolated DNA
Qubit dsDNA HS Assay Kit	Thermo Fisher Scientific	Q32851	For quantification of isolated DNA
0.5 mL tube	Axygen	10011-830	For quantification by Qubit
Phenol/chloroform/isoamyl alcohol (25:24:1)	Nacalai Tesque	25970-56	To purify DNA from lysate
AMPure XP beads	Beckman Coulter	A63881	SPRI magnetic beads for library preparation
Metal ice rack	Funakoshi	IR-1	To keep the cell lysate frozen
Sample Cooler	New England Biolabs	T7771S	Helps fix cells with minimal damage
2100 Bioanalyzer	Agilent Technologies	G2939BA	To check the quality of isolated DNA fragments. Another fragment analyzer can be used.
Bioanalyzer 2100 Expert Software	Agilent Technologies	G2946CA	Supplied with the Bioanalyzer
High Sensitivity DNA Kit	Agilent Technologies	5067-4626	To check the quality of the isolated DNA fragments
KAPA LTP Library Preparation Kit	Roche	07961898001	Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution
NEXTflex DNA Barcodes	BIOO Scientific	NOVA-514101	Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.
KAPA Real-Time Library Amplification Kit	Roche	07959028001	Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards
2x KAPA HiFi HotStart ReadyMix	Roche	KM2602	For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit
Buffer EB	Qiagen	19086	10 mM Tris-Cl, pH 8.5 for elution of DNA
386-well qPCR plate	Thermo Fisher Scientific	4309849	For real-time PCR
QuantStudio 7 Flex Real-Time PCR System	Thermo Fisher Scientific	4485701	To quantify DNA
MicroAmp Optical Adhesive Film	Thermo Fisher Scientific	4311971	For real-time PCR
MicroAmp Clear Adhesive Film	Thermo Fisher Scientific	4306311	For plate sealing
End-repair master mix			Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O
A-taling master mix			Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O
Ligation buffer mix			Combine 2 µL of KAPA ligation buffer and 6 µL of H2O
Real-time PCR master mix			Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O
PCR master mix			Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O
Integrative Genomics Viewer	Broad Institute	IGV_2.3.88	Genome browser to visualize sequencing data
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′	Eurofins Genomics		A primer to amplify the promoter region of GAPDH
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′	Eurofins Genomics		A primer to amplify the promoter region of GAPDH
SYBR Premix Ex Taq	Takara	RR420L	To quantify the DNA corresponding to the GADPH promoter region
Thermal Cycler Dice	Takara	TP870	To quantify the DNA corresponding to the GADPH promoter region