The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data.
The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for application. Due to the drastic differences between the aptamer and small molecules, scientists need to put much effort into characterizing their binding properties. Isothermal Titration Calorimetry (ITC) is a powerful approach for this purpose. ITC goes beyond determining disassociation constants (Kd) and can provide the enthalpy changes and binding stoichiometry of the interaction between two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration, so the process can sensitively measure the binding between macromolecules and their small targets. Herein, the article introduces a step-by-step procedure of the ITC measurement of a selected aptamer with a small target, tetracycline. This example proves the versatility of the technique and its potential for other applications.
Aptamers are ssDNA or RNA fragments selected through an evolution process with high binding affinity and specificity to the desired targets1,2, which can work as advanced recognition elements or chemical antibodies3,4,5. Thus, the binding affinity and specificity of aptamers to their targets play a crucial role in the selection and application of an aptamer, and Isothermal Titration Calorimetry (ITC) has been widely used for these characterization purposes. Many approaches have been used to determine the affinity of aptamers, including ITC, surface plasmon resonance (SPR), colorimetric titration, microscale thermophoresis (MST), and Bio-Layer Interferometry (BLI). Among them, ITC is one of the latest techniques to determine the thermodynamic and kinetic association of two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration6,7. Unlike other methods, ITC can offer binding affinity, several binding sites, and thermodynamic and kinetic association (Figure 1A). From these initial parameters, the Gibbs free energy changes and entropy changes are determined using the following relationship:
ΔG = ΔH-TΔS
That means that ITC offers a complete thermodynamic profile of the molecular interaction to elucidate the binding mechanisms (Figure 1B). Determining the binding affinity for small molecules with an aptamer is difficult due to the drastically different sizes between aptamer and target. Meanwhile, ITC can provide sensitive measurement without labeling and immobilizing molecules, which provides a means of keeping the natural structure of the aptamer and target during measurement. With the mentioned attributes, ITC can be used as the standard method for the characterization of binding between an aptamer and small targets.
After selection by the Gu group, this aptamer was integrated with different platforms, including electrochemical aptamer-based biosensors, a competitive enzyme-linked aptamer assay, and a microtiter plate, which can achieve high-throughput detection of tetracycline8,9,10. However, its binding characteristics have not been elucidated well enough to choose the proper platform8; it is worth characterizing the binding of the aptamer to the tetracycline using ITC.
The method presented here was modified according to instruction from TA Instruments and is sufficient to determine the binding affinity and thermodynamics of many selected aptamers and targets at our center. Crucial steps from this procedure include exchanging the buffer to have a target matching the ligand, running samples with proper parameters, and finding the appropriate binding fitting model to analyze the data. Continuous recording of heat release requires eliminating all noise heat, such as from mismatch of the bu…
The authors have nothing to disclose.
This research was supported by the Research and Development Funding from Aptagen LLC.
5'-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG C TTGGGTTGGTCCCACTGCGCG TGGATCCGAGCTCCAC GTG-3' |
Integrated DNA Technologies, Inc | The sequence is adopted from Gu's research, which has not identified Kd using ITC (refer references 8 and 9) | |
Affinity ITC Auto Low Volume (190 µL) System Complete–Gold Cells | TA Instruments | 61000.901 | Isothermal titration calorimetry system |
CaCl2 | Avantor (VWR) | E506-100ML | Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile |
Centrifuge | Eppendorf | 5417R | The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g. |
Complete Degassing Station (110/230V) | TA Instruments | 6326 | This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation. |
EDTA | TekNova | E0375 | EDTA 500 mM, pH 7.5 |
NanoDrop One Microvolume UV-Vis Spectrophotometer | ThermoFisher | ND-ONE-W | UV-Vis Spectrophotometer |
Nanosep, Nanosep MF and NAB Centrifugal Devices | Pall Laboratory | OD030C34 | 3 kDa molecular weight cutoff concentrator |
PBS pH 7.4 | IBI Scientific | IB70165 | Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 µm filter. Autoclaved at 121 °C for greater than 20 min. |
Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes | labForce (a Thomas Scientific Brand) | 1149K01 | |
Tetracycline, Hydrochoride | EMD Millipore Corperation | CAS64-75-5 |