A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.
Zirkulierende (zellfreier) microRNAs (miRNAs) von Zellen in den Blutstrom freigesetzt. Die Menge der spezifischen mikroRNAs im Zirkulations wurde einem Krankheitszustand verbunden und hat das Potential als Krankheits Biomarkers verwendet werden. A sensitive und genaue Methode MikroRNA Quantifizierung zum Zirkulieren eines farbstoffbasierte Chemie und digitalen PCR Technologie Tröpfchens wurde vor kurzem entwickelt. Insbesondere Locked unter Verwendung Nukleinsäure (LNA) miRNA-spezifische Primer mit einem grünen fluoreszierenden DNA-bindenden Farbstoff in einem kompatiblen digital Tröpfchen PCR System -basierte es ist möglich, die absolute Quantifizierung von spezifischen miRNAs zu erhalten. Hier beschreiben wir, wie diese Technik darstellende miRNA Menge in biologischen Flüssigkeiten, zu beurteilen, wie Plasma und Serum, ist sowohl möglich als auch effektiv.
MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14.
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.
Zirkulieren miRNAs sind im Blut bei extrem niedrigen Konzentrationen und die Menge an RNA, die aus Plasma und Serumproben extrahiert werden kann, ist gering. Aus diesem Grund sind sie schwierig mit anderen Techniken wie Mikroarray und RNA-Sequenzierung zu quantifizieren. Darüber hinaus gibt es eine verallgemeinerte keine Einigung über die Datennormalisierung und die Anwesenheit von endogenen "Referenz" miRNAs im Blut. In diesem Zusammenhang ist eine sensible Technik wie Tröpfchen digitale PCR, der fähig is…
The authors have nothing to disclose.
Unterstützt von der italienischen Vereinigung der Finanzierung für Krebsforschung (AIRC) zu MF (MFAG 11676) und MN (Special Program Molecular Clinical Oncology -. 5 Promille n 9980, 2010/15) und aus dem italienischen Ministerium für Unterricht, Universitäten und Forschung FIRB 2011 MN (Projekt RBAPIIBYNP).
miRNeasy Mini Kit | Qiagen | 217004 | Columns for total RNA, including miRNA, extraction from serum/plasma |
100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | Custom | Sequence: UCACCGGGUGUAAAUCAGCUUG |
Universal cDNA synthesis kit II, 8-64 rxns | Exiqon | 203301 | Kit for microRNA reverse transcription |
MicroRNA LNA PCR primer set | Exiqon | 204000-206xxx and 2100000-21xxxxx | Primers for miRNA amplification inside droplets |
QX200 droplet generator | BioRad | 186-4002 | Instrument used for droplet reading |
QX200 droplet reader | BioRad | 186-4003 | Instrument used for droplet generation |
QuantaSoft software | BioRad | 186-3007 | Software for data collection and analysis |
PX1 PCR plate sealer | BioRad | 181-4000 | Plate sealer |
DG8 droplet generator cartridges and gaskets | BioRad | 186-4008 | Cartridges used to mix sample and oil to generate droplets |
QX200 ddPCR EvaGreen supermix | BioRad | 186-4033/36 | PCR supermix |
QX200 droplet generator oil for EvaGreen dye | BioRad | 186-4005 | Oil for droplet generation |