TChIP-Seq: Epigenoma célula tipo-específicas de criação de perfil
Summary
Descreveremos um protocolo passo a passo para cromatina em tandem da imunoprecipitação sequenciamento (tChIP-Seq) que permite a análise da modificação do histone todo o genoma de célula tipo-específicas.
Abstract
Epigenético regulamento tem um papel central na expressão gênica. Desde que a modificação do histone foi descoberta na década de 1960, suas funções fisiológicas e patológicas têm sido muito estudadas. Com efeito, o advento da próxima geração sequenciamento profundo e imunoprecipitação da cromatina (ChIP) através de anticorpos de modificação de histona específico tem revolucionado o nosso ponto de vista do Regulamento epigenético através do genoma. Por outro lado, tecidos tipicamente consistem em tipos de diversas células, e sua mistura complexa coloca desafios analíticos para investigar a Epigenoma em um tipo específico de célula. Para resolver o estado de cromatina de tipo específico de célula em uma forma de todo o genoma, desenvolvemos recentemente em tandem da cromatina imunoprecipitação sequenciamento (tChIP-Seq), que se baseia a purificação seletiva da cromatina de proteínas de histona marcados do núcleo da célula tipos de interesse, seguido de ChIP-Seq O objetivo do presente protocolo é a introdução de melhores práticas de tChIP-Seq Esta técnica fornece uma ferramenta versátil para a investigação de tecido-específica Epigenoma em modificações do histone diversificada e organismos modelo.
Introduction
Tecidos de animais consistem em tipos de células diferentes. A regulação dos genes em cada célula define o tipo de célula. Modificações da cromatina – DNA metilação e histona modificação – fundamentam a especificidade do tipo de célula da expressão do gene. Assim, a medição do Regulamento epigenética em cada tipo de célula tem sido desejada, mas tem sido um desafio técnico.
Para investigar a epigenética em um tipo específico de célula, sequenciamento de imunoprecipitação da cromatina em tandem (tChIP-Seq) foi recentemente desenvolvido (Figura 1)1. Em tChIP, proteína de núcleo com tag epítopo histona H2B é expressa de um promotor de célula tipo-específico. Este recurso permite o isolamento de chromatins partir de células de interesse, embora o material começa a partir de uma mistura de vários tipos de células. ChIP-Seq seguir — purificação da cromatina, através de um modificado-histona marca e geração de sequenciamento profundo de isolado DNA — pode monitorar o status epigenético o tipo de células alvo de forma todo o genoma.
Usando esta técnica, investigamos recentemente neurônio específico trimethylation de histona H3 proteína em lisina (H3K4me3) de 4 marcas. Nesse estudo, nós desenvolvemos um rato bate-no qual C-terminal bandeira-tag H2B proteína foi expressa sobre recombinação mediada por Cre (Rosa26Floxed-pA CAG H2B-bandeira). Por cruzamento com um rato, possuindo o Cre-endoplasmic gene endoplasmático (ER) sob o controle do promotor CamK2a, a linha obtidos rato induzido H2B-bandeira nos neurônios ativos sobre tamoxifeno injeção (Camk2aH2B-bandeira)1. A partir do cérebro da linha estabelecida rato, realizamos tChIP-Seq com anticorpo anti-H3K4me3. Desde que H3K4me3 marcas muitas vezes correspondem a regiões do promotor, poderia descobrir centenas de mRNAs especificamente expressados em neurônios1.
Aqui, descrevemos um método típico tChIP-Seq que cobre as etapas de dissecção de tecidos para a construção da biblioteca (Figura 1). O objetivo final do presente protocolo é compartilhar nossas melhores práticas para o desempenho de tChIP-Seq e a aplicação futura deste método para outros tipos de células e modificações do histone.
Protocol
Representative Results
Discussion
Nosso protocolo foi otimizado para os neurônios do cérebro do rato, em que a expressão da bandeira-tag H2B é induzida pela injeção de tamoxifeno. Promotores utilizados para H2B expressão, matérias-primas tecido e a quantidade dos tecidos são parâmetros cruciais para sucesso tChIP-Seq Assim, a otimização desses fatores deve ser considerada para cada tipo de célula de interesse.
Um passo crítico entre os procedimentos utilizados neste protocolo é o DNA de tosquia para atingir um c…
Divulgaciones
The authors have nothing to disclose.
Acknowledgements
Agradecemos a todos os membros do laboratório Iwasaki para leitura crítica do manuscrito. Este trabalho foi financiado em parte por um subsídio para a investigação científica em áreas inovadoras (26113005 # S.N. e JP17H05679 o S.I.); um subsídio para jovens cientistas (A) (JP17H04998 o S.I.) do Ministério da educação, ciência, esportes e cultura do Japão (MEXT); e as pioneiras projetos “Evolução celular” e todo projeto RIKEN “Doença e Epigenoma” de RIKEN (para S.N. e S.I.).
Materials
| Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
| Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
| DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
| 8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
| SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
| Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
| 2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
| 2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
| 16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
| Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
| D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
| HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
| 5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| 0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
| NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
| Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
| Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
| 0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
| Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
| RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
| milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
| Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
| UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
| RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
| Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
| Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
| Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
| Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
| Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
| 10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
| Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
| Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
| Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
| Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
| 0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
| Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
| AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
| Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
| Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
| 2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
| Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
| High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
| KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
| NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
| KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
| 2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
| Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
| 386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
| QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
| MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
| MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
| End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
| A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
| Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
| Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
| PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
| Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
| DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
| Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |
Referencias
- Mito, M., et al. Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing. Scientific Reports. 8 (1), 1143 (2018).
- Kadota, M., et al. CTCF binding landscape in jawless fish with reference to Hox cluster evolution. Scientific Reports. 7 (1), 4957 (2017).
- Jung, Y. L., et al. Impact of sequencing depth in ChIP-seq experiments. Nucleic Acids Research. 42 (9), (2014).
- Becker, P. B., Workman, J. L. Nucleosome remodeling and epigenetics. Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).
- Kidder, B. L., Zhao, K. Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells. Methods in Molecular Biology. , 3-20 (2014).
- Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
- Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nature Methods. 12 (10), 963-965 (2015).
- Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34 (36), 11929-11947 (2014).
- Hornstein, N., et al. Ligation-free ribosome profiling of cell type-specific translation in the brain. Genome Biology. 17 (1), 149 (2016).
- Zhao, Y., Garcia, B. A. Comprehensive catalog of currently documented histone modifications. Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).
- Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. Formaldehyde crosslinking: a tool for the study of chromatin complexes. The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).
