Summary

Genome-wide Gene Deletioner i<em> Streptococcus sanguinis</em> Av High Throughput PCR

Published: November 23, 2012
doi:

Summary

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Abstract

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5′ end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Protocol

1. Primer Design Primers are designed using in house scripts based on the S. sanguinis SK36 genome sequence. Three sets of primers, F1/R1, F2/R2, and F3/R3 are designed for amplification of the 1-kb upstream sequence of the target gene, the aphA-3 gene encoding kanamycin resistance (Kmr) protein3 and the 1-kb downstream sequence of the target gene, respectively (Figure 1). Among these primers, F1 and R3 are designed using ePrimer3 in the EMBOSS suite of…

Representative Results

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t…

Discussion

To minimize the possible polar effects of the replacement of one targeted gene with exogenous antibiotics gene on neighboring genes, two steps are taken while initial primer designing. For most of deleted genes, the primers R1 and F3 are designed to delete the coding region from 6 bp following the start codon to 30 bp prior to the stop codon. The last 30 base pairs are retained to protect potential ribosomal binding site used by the adjacent downstream gene. The retained region between two neighboring genes is extended t…

Divulgations

The authors have nothing to disclose.

Acknowledgements

This work was supported by grants R01DE018138 from the National Institutes of Health (PX) and in part, by Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144602-3 (PX). We thank Drs. Lei Chen, Yuetan Dou and Xiaojing Wang for assisting with the construction of genome wide mutants. We also thank the DNA Core Facility at Virginia Commonwealth University for DNA sequencing.

Materials

Names Company Catalog# Comments (optional)
Primer F2 Integrated DNA Technologies TGACTAACTAGGAGGAATAAATG
GCTAAAATGAGAATAT
Primer R2 ibid CATTATTCCCTCCAGGTACTAAAA
CAATTCATCCAGT
Primer F2p ibid GATAAACCCAGCGAACCATTTGA
Primer P1 ibid GCTTATATACCTTAGCAGGAGACA
Primer P2 ibid GTATGACATTGCCTTCTGCGTCC
Primer 5′ end_R1_seq ibid GCCATTTATTCCTCCTAGTTAGTCA
Primer 5′ end_F3_seq ibid GTTTTAGTACCTGGAGGGAATAATG
Primer 5′ end_R1p_seq ibid CCTCAAATGGTTCGCTGGGTTTATC
CSP Synprep Sequence:NH2-DLRGVPNPWGWIFGR-COOH
DNA Polymerase Invitrogen 11304-102 Platinum Taq DNA Polymerase High Fidelity
EcoRI New England Biolabs Inc R0101S Restriction enzyme
Agar American Bioanalytical AB01185
Agarose Promega V3125
BHI BD Biosciences 237500 Brain Heart Infusion
Horse serum Fisher Scientific SH3007403 Horse serum
Km Fisher Scientific BP906-5 Kanamycin
TH broth BD Biosciences 249240 Todd Hewitt broth
PureLink 96 Invitrogen K310096 PureLink 96 PCR purification kit
QIAquick Qiagen 28106 QIAquick PCR purification kit
Filter Corning 431117 0.22 μm polystyrene filter
Anoxomat System Mart Microbiology b.v. Anoxomat Mark II
Benchtop centrifuge Thermo Scientific 75004377 Sorvall Legend RT Plus microplate rotor
Gel Documentation UVP LLC BioDoc-It 210
Incubator Fisher Scientific 11-690-625D Isotemp
Labnet’s Gel XL Labnet E0160 Labnet’s Gel XL
Microcentrifuge Eppendorf 22621408 Microcentrifuge 5415 R
Multichannel pipettes Thermo Scientfic 4661040, 4661020 Finnpipette F1
Thermal Cycler Applied Biosystems Inc. N805-0200 GeneAmp PCR system 9700

References

  1. Sassetti, C. M., Boyd, D. H., Rubin, E. J. Genes required for mycobacterial growth defined by high density mutagenesis. Mol. Microbiol. 48, 77-84 (2003).
  2. Kobayashi, K., et al. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).
  3. Trieu-Cuot, P., Courvalin, P. Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3’5″-aminoglycoside phosphotransferase type III. Gene. 23, 331-341 (1983).
  4. Paik, S., et al. Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis. Infect. Immun. 73, 6064-6074 (2005).
  5. Lukomski, S., et al. Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization. Infect. Immun. 68, 535-542 (2000).
  6. Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, (2006).
  7. de Berardinis, V. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174 (2008).
  8. Rodriguez, A. M., et al. Physiological and molecular characterization of genetic competence in Streptococcus sanguinis. Mol. Oral. Microbiol. 26, 99-116 (2011).
  9. Perry, D., Kuramitsu, H. K. Genetic transformation of Streptococcus mutans Infect. Immun. 32, 1295-1297 (1981).
  10. Pakula, R., Walczak, W. On the nature of competence of transformable streptococci. J. Gen. Microbiol. 31, 125-133 (1963).
  11. Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).
  12. Xu, P., et al. Genome-wide essential gene identification in Streptococcus sanguinis. Sci. Rep. 1, (2011).
check_url/fr/4356?article_type=t

Play Video

Citer Cet Article
Ge, X., Xu, P. Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR. J. Vis. Exp. (69), e4356, doi:10.3791/4356 (2012).

View Video