Indução de Maternal Immune Activation em Ratos na Fase Mid-gestação com Viral Mimic poli (I: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
O conceito de ativação imune materna (MIA) tem origem nos estudos epidemiológicos sobre a associação da infecção materna com autismo e esquizofrenia 1. Devido à ausência de agentes patogénicos virais detectáveis se replicar na placenta ou do cérebro fetal após a infecção viral materna 2,3, o efeito da infecção sobre a descendência é a hipótese de ser causadas pela activação do sistema imune materno, em vez do que os próprios agentes patogénicos .
Para elucidar a relação de causa e efeito entre MIA e distúrbios psiquiátricos, injecção de quimicamente sintetizados, viral mímico dupla polyinosinic ARN de cadeia: ácido polycytidylic (poli (I: C)) em roedores grávida tem sido amplamente utilizado como modelo animal para a MIA 4,5. Poli (I: C) é reconhecida pelo receptor? Toll-like 3 (TLR3), e a administração sistémica de poli (I: C) induz-viral como a resposta inflamatória aguda. Um dos mecanismos pelos quais a poli (I: C) PRoduces anomalias comportamentais e neuropatologias na prole é por causando um desequilíbrio de citocinas pró-inflamatórias e anti no eixo materno-placentária-fetal 6. Vários grupos adotaram o modelo MIA para compreender a etiologia dos transtornos psiquiátricos 7, e devido aos diversos interesses entre grupos de pesquisa, vários pontos de tempo de ativação imune têm sido utilizados para alcançar diferentes perturbações no desenvolvimento do cérebro e comportamentos 7.
O laboratório Paul H. Patterson no Califórnia Institute of Technology adota a estratégia de injecção de poli (I: C) em murganhos grávidas no dia embrionário 12,5 (E12.5), que demonstrou com sucesso que a MIA é capaz de induzir comportamental, neurológica, e alterações imunológicas na descendência que estão associados com a esquizofrenia e autismo 8-11. Nossas obras anteriores mostram que MIA prole apresentar anomalias comportamentais (por exemplo, impairmen sociaist, défice de comunicação, comportamentos repetitivos, comportamento de ansiedade-like, e latente déficit de inibição 8,10,12), imune desregulação e citocinas desequilíbrio 8,13,14, alteração da expressão do gene do cérebro fetal 15, perda de células de Purkinje no lóbulo VII do cerebelo 11, alteração de propriedades sinápticas no hipocampo 9, gene x interação ambiente 13, alteração da permeabilidade do intestino e intestino composição da microbiota 16. Além disso, as estratégias terapêuticas e profiláticas são também desenvolvido a partir deste sistema modelo 13,16,17. Ao induzir MIA em E12.5, outros mostraram que MIA produz ativação fetal microglial e alteração de desenvolvimento colinérgicos no cérebro anterior basal 18, cepa específica de interacção 19, anormalidades ultra-estruturais do cérebro sinaptossomais cerebral, mitocondriais respiratórias anormalidades cadeia hiperfunção, o downregulation das moléculas sinaptossomais cerebrais 17 ,comportamentos de tipo depressivo, déficit cognitivo e do hipocampo potenciação de longa duração (LTP) e déficit de neurogênese adulta 20.
Aqui, nós fornecemos um método detalhado de como induzir MIA em E12.5 por poli (I: C), bem como os paradigmas de como aplicar este modelo para estudar a etiologia da esquizofrenia e autismo. É importante notar que a MIA é um factor de risco para uma variedade de distúrbios 4, e os seus resultados são extremamente sensíveis ao tempo e método de indução, bem como a criação de barragens grávidas. Como tal, mesmo pequenas inconsistências entre laboratórios muitas vezes resultam em baixa reprodutibilidade e / ou diferentes fenótipos na descendência. Nosso método é projetado especificamente para os interessados em estudar MIA como um fator de risco ambiental para o autismo e esquizofrenia, e a descrição detalhada fornecida irá ajudar os pesquisadores a melhorar a reprodutibilidade dos seus dados.
Protocol
Representative Results
Discussion
indução MIA em diferentes janelas de tempo perturba diferentes eventos de desenvolvimento cerebral em roedores e, consequentemente, leva a anomalias comportamentais diferentes e neuropatologias na prole. Aqui, descrevemos um protocolo para induzir MIA em camundongos com poli (I: C) injecção a E12.5. Este método de indução MIA leva a comportamental, neurológica, imunológico, e anomalias gastrointestinais associados com o autismo e esquizofrenia na prole 8,10,11,16. É importante notar que, porque MIA …
Divulgations
The authors have nothing to disclose.
Acknowledgements
Nós gostaríamos de homenagear o falecido Dr. Paul H. Patterson por suas contribuições para o progresso do modelo MIA, autismo e pesquisa da esquizofrenia. Nós reconhecemos Sarkis K. Mazmanian por seu grande apoio a este protocolo; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, e Leslie A. Neumann de assistência administrativa; Ali Khoshnan e Jan C. Ko para a assistência sobre as filmagens; Elaine Y. Hsiao e Natalia Malkova para os seus conselhos na indução MIA; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, e Natalie A. Verduzco para a sua criação de animais especialista. Este trabalho foi financiado pelo NIH Award Conte Center (NIH 5P50MH086383-04, de Paul H. Patterson); Autism Speaks (# 7670, a Paul H. Patterson); Fundação Simons (# 322839, com Sarkis K. Mazmanian); NIH Training Grant (NIH / NRSA T32GM07616 de K.-HC); Caltech Verão Graduação Research Fellowship (SURF) (para ZY); Amgen Scholars Programa no Caltech (para ZY); e pós-doutorado frConselho om National Science, Taiwan (NSC 101-2917-I-564-039, para W.-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
References
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H. et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., & Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I. et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., & Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., & Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., & Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., & Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L. et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., & Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L. et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., & McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., & Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2 e98 (2012).
- Hsiao, E. Y. et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K. et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., & Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J. et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3 e240 (2013).
- Khan, D. et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4 e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., & Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B. et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U. et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S. et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., & Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., & Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
