Induksjon av Maternal immunaktivering hos mus ved Mid-svangerskap scenen med Viral Mimic Poly (I: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
Konseptet av mors immunaktivering (MIA) stammer fra epidemiologiske studier om sammenhengen mellom mors infeksjon med autisme og schizofreni en. På grunn av fravær av påvisbare replikerende retroviral patogener i placenta eller føtal hjerne etter maternal virusinfeksjon 2,3, blir virkningen av infeksjonen på avkommet antatt å være forårsaket av aktivering av morens immunsystemet i stedet for patogener selv .
Å belyse årsak-virkning forholdet mellom MIA og psykiatriske lidelser, injeksjon av kjemisk syntetisert, viral ligne dobbelttrådet RNA polyinosinic: polycytidylic syre (poly (I: C)) til gravide gnagere har blitt mye brukt som dyremodell for MIA 4,5. Poly (I: C) er anerkjent av toll-like receptor 3 (TLR3), og systemisk administrasjon av poly (I: C) induserer viruslignende akutt betennelsesreaksjon. En av de mekanismer som poly (I: C) produces unormal oppførsel og neuro-patologi hos avkommet er ved å forårsake en ubalanse i pro- og antiinflammatoriske cytokiner i mors-placenta-føtal akse 6. Flere grupper har tatt i MIA-modellen for å forstå etiologien av psykiatriske forstyrrelser 7, og på grunn av de forskjellige interesser blant forskergrupper har forskjellige tidspunkter for aktivering av immunsystemet blitt benyttet for å oppnå forskjellige perturbasjoner på utvikling av hjernen og atferd 7.
Paul H. Patterson laboratorium ved California Institute of Technology vedtar strategien med å injisere poly (I: C) i drektige mus på embryonale 12,5 dager (E12.5), som har bevist at MIA er i stand til å fremkalle atferds, nevrologiske, og immunologiske endringer i avkom som er forbundet med autisme og schizofreni 8-11. Våre tidligere verker viser at MIA avkom viser atferdsforstyrrelser (f.eks sosiale impairment, kommunikasjon underskudd, repeterende atferd, angst-lignende oppførsel, og latent hemning underskudd 8,10,12), immun feilregulering og cytokiner ubalanse 8,13,14, endring av fosterets hjerne genekspresjon 15, tap av Purkinje celle i lobule VII av cerebellum 11, endring av synaptiske eiendommer i hippocampus 9, gen x miljø samspill 13, endring av gut permeabilitet, og gut microbiota sammensetning 16. Videre er terapeutiske og forebyggende strategier også utviklet seg fra denne modellen systemet 13,16,17. Ved å fremkalle MIA E12.5, andre har vist at MIA produserer foster microglial aktivering og kolinerge utviklings endring i basale forhjerne 18, stammespesifikk interaksjon 19, hjernen cerebral synaptosomale ultra unormalt, cerebral mitokondrie respiratoriske kjeden hyper abnormalties, nedregulering av cerebral synaptosomale molekyler 17 ,depressiv-lignende atferd, svekkelse i kognisjon og hippocampus langsiktig (LTP), og underskudd på voksen hippocampus neurogenesis 20.
Her gir vi en detaljert metode for hvordan å indusere MIA E12.5 av poly (I: C), samt paradigmer av hvordan du skal bruke denne modellen til å studere etiologien av autisme og schizofreni. Det er viktig å merke seg at MIA er en risikofaktor for en rekke lidelser 4, og dens resultater er ekstremt følsomme for tiden og fremgangsmåte for induksjons samt oppdrett av gravide dammer. Som sådan, selv mindre uoverensstemmelser mellom laboratorier ofte resultere i lav reproduserbarhet og / eller forskjellige fenotyper hos avkommet. Vår metode er spesielt designet for de som er interessert i å studere MIA som miljø risikofaktor for autisme og schizofreni, og den detaljerte beskrivelsen som blir gitt vil hjelpe forskere bedre reproduserbarhet av sine data.
Protocol
Representative Results
Discussion
MIA induksjon ved forskjellige tidsvinduer perturbs ulike hjernens utvikling hendelser i gnagere, og dermed fører til ulike atferdsmessige abnormiteter og neuro-patologi hos avkommet. Her beskrev vi en protokoll for å indusere MIA i mus med poly (I: C) injeksjon ved E12.5. Denne metoden for MIA induksjon fører til atferds, nevrologiske, immunologiske og gastrointestinale misdannelser assosiert med autisme og schizofreni hos avkommet 8,10,11,16. Det er viktig å merke seg at, fordi MIA er en miljømessig ri…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Vi ønsker å hedre den avdøde Dr. Paul H. Patterson for hans bidrag til utviklingen av MIA modell, autisme og schizofreni forskning. Vi erkjenner Sarkis K. Mazmanian for sin store støtte på denne protokollen; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, og Leslie A. Neumann for administrativ bistand; Ali Khoshnan og Jan C. Ko for assistanse på filming; Elaine Y. Hsiao og Natalia Malkova for deres råd om MIA induksjon; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, og Natalie A. Verduzco for deres ekspert dyrehold. Dette arbeidet ble støttet av NIH Conte Senter Award (NIH 5P50MH086383-04, Paul H. Patterson); Autism Speaks (# 7670, til Paul H. Patterson); Simons Foundation (# 322839, til Sarkis K. Mazmanian); NIH Trening Grant (NIH / NRSA T32GM07616 til K.-HC); Caltech Sommer Undergraduate stipend (SURF) (til ZY); Amgen Scholars Program ved Caltech (til ZY); og postdoktorstipend from National Science Council, Taiwan (NSC 101-2917-I-564-039, til W.-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
References
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H., et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I., et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L., et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L., et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. , (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31, 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2, e98 (2012).
- Hsiao, E. Y., et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K., et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J., et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3, e240 (2013).
- Khan, D., et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4, e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B., et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U., et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S., et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
