JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Résultats
Discussion
Divulgations
Acknowledgements
Materials
References
Traduction automatique
Please note that all translations are automatically generated. Click here for the English version.
Médecine

preparazione e<em> In Vitro</em> Caratterizzazione di magnetizzato miR-modificato cellule endoteliali

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

Questo manoscritto descrive l'erogazione efficiente, non virale miR alle cellule endoteliali da un vettore PEI / MNP e la loro magnetizzazione. Così, oltre alla modificazione genetica, questo approccio consente di orientamento delle cellule magnetica e risonanza magnetica rilevabilità. La tecnica può essere utilizzata per migliorare le caratteristiche dei prodotti cellulari terapeutici.

Abstract

Fino ad oggi, i trattamenti chirurgici e farmacologici disponibili per le malattie cardiovascolari (CVD) sono limitati e spesso palliative. Allo stesso tempo, terapie geniche e cellulari sono approcci alternativi promettenti per il trattamento CVD. Tuttavia, l'ampia applicazione clinica della terapia genica è fortemente limitato dalla mancanza di idonei sistemi di trasferimento genico. Lo sviluppo di adeguate vettori di trasferimento genico in grado di fornire una soluzione alle sfide attuali in terapia cellulare. In particolare, gli svantaggi esistenti, come l'efficienza limitata e ritenzione delle cellule di basso nell'organo danneggiato, potrebbero essere superati mediante l'ingegneria cella appropriata (cioè, genetica) prima del trapianto. Il protocollo presentato descrive la modificazione transitoria efficiente e sicura delle cellule endoteliali mediante una nanoparticella polietilenimmina superparamagnetico magnetico (PEI / MNP) consegna basata su vettore. Inoltre, l'algoritmo e metodi per la caratterizzazione delle cellule sono definite. Il successo intracelluconsegna LAR di microRNA (miR) nella vena ombelicale cellule endoteliali umane (HUVEC) è stato raggiunto senza compromettere la vitalità cellulare, la funzionalità, o comunicazione intercellulare. Inoltre, questo approccio è stato dimostrato di causare un forte effetto funzionale esogeno introdotto miR. È importante sottolineare che l'applicazione di questo vettore MNP-based assicura magnetizzazione cella, con possibilità di targeting magnetico e non invasivo MRI tracing accompagnamento. Questo può fornire una base per magneticamente guidate, terapie cellulari geneticamente ingegnerizzati che possono essere monitorati in modo non invasivo con MRI.

Introduction

Terapia genica e cellulare sono strumenti potenti che hanno il potenziale per risolvere le sfide attuali nel trattamento CVD. Nonostante il fatto che entrambi questi approcci sono attualmente in fase di sperimentazione in studi clinici, non sono ancora pronti per una vasta applicazione clinica 1. In particolare, un approccio comune per affrontare le sfide della terapia genica e cellulare è quello di sviluppare vettori di trasferimento dei geni multifunzionali adatte per l'applicazione clinica. La mancanza di sistemi di lancio gene sicuri ed efficienti è la preoccupazione principale della terapia genica. Allo stesso tempo, l'ingegnerizzazione genetica di prodotti cellulari prima del trapianto potrebbe superare le gravi sfide della terapia cellulare, come la bassa efficienza (trapianto di cellule post-staminali per esempio, nel campo cardiaco, solo ~ 5% di miglioramento funzionale si ottiene 1 ) e la scarsa ritenzione / attecchimento presso il sito di lesione (ad esempio, la conservazione delle cellule scende sotto i 5 – 10% in pochi minuti a ore Post-applicazione, indipendentemente dalla via di somministrazione 2, 3, 4).

Fino ad oggi, vettori virali superano notevolmente i sistemi non-virali in termini di efficienza, che ha portato nella loro più ampia applicazione negli studi clinici (~ 67%) 5. Tuttavia, i veicoli virali comportano rischi gravi, come immunogenicità (e la successiva risposta infiammatoria, con gravi complicazioni), oncogenesi e limitazioni nella dimensione del materiale genetico condotto 6. A causa di questi problemi di sicurezza e gli elevati costi di produzione vettore virale, l'uso di sistemi non virali è preferibile in alcuni casi 7, 8. È particolarmente adatto per i disturbi che richiedono correzione genetica transitoria, come l'espressione dei fattori di crescita che controllano l'angiogenesi (ad esempio, per il trattamento CVD) o delivery di vaccini.

Nel nostro gruppo, un sistema di erogazione creata da combinando ramificato polietilenimmina 25-kDa (PEI) e nanoparticelle di ossido di ferro superparamagnetiche (MNP) legati insieme da interazione biotina-streptavidina 9. Questo vettore è un potenziale strumento per l'ingegneria genetica di cellule, consentendo loro magnetizzazione simultanea prima del trapianto. Quest'ultimo fornisce una base per magnetico orientamento / ritenzione, che è particolarmente promettente al giorno d'oggi, come tecniche avanzate di targeting magnetici si stanno sviluppando con successo 10. Inoltre, le risultanti cellule magneticamente sensibili hanno il potenziale di essere non invasivo monitorato da risonanza magnetica (MRI) o immagini di particelle magnetiche 11, 12.

Nel caso del vettore PEI / MNP, poliammina assicura condensazione di acido nucleico e quindi la protezione dal fattore degradanti s, vettore internalizzazione nelle cellule, e endosomali fuga 5. Il MNPs completano le proprietà di PEI, non solo in termini di orientamento magnetico, ma anche riducendo il noto tossicità PEI 7, 13, 14. In precedenza, PEI / MNP proprietà vettoriali sono stati regolati in termini di efficienza di consegna (cioè, pDNA e miRNA) e sicurezza utilizzando fibroblasti e cellule staminali mesenchimali umane 15, 16.

In questo manoscritto, un protocollo dettagliato sull'applicazione della PEI / MNPs per la generazione di cellule miRNA-modificata viene descritto 17. Per questo scopo, vengono utilizzate HUVEC e rappresentano un modello stabilito per l'angiogenesi in vitro. Sono impegnativo per trasfettare e sono suscettibili di influenza tossica 18, 19,ass = "xref"> 20. Inoltre, mettiamo a disposizione un algoritmo per valutare tali cellule in vitro, compresa la loro targeting, la comunicazione intercellulare, e la rilevazione risonanza magnetica.

Protocol

Cordoni ombelicali umani per l'isolamento delle cellule sono stati ottenuti dopo il parto dalla informati, donne sane che hanno dato il loro consenso scritto per l'uso di questo materiale per la ricerca in base alla Dichiarazione di Helsinki. Il comitato etico dell'Università di Rostock ha approvato lo studio presentato (reg. No. Un 2011 06, prolungato 23 settembre, 2013). 1. Preparazione di Transfection Complessi Biotinilazione di polietilenimmina (PEI). <ol…

Representative Results

Lo scopo principale del protocollo proposto è di produrre risposte magnetiche cellule miR-modificati e condurre loro caratterizzazione accurata (Figura 1). Di conseguenza, le cellule in modo efficiente trasfettate, sensibili alla selezione magnetica e di orientamento e rilevabili con la risonanza magnetica, devono essere ottenuti. In primo luogo, le identità di HUVEC isolati sono stati confermati mediante co…

Discussion

La produzione di cellule geneticamente modificate cariche di nanoparticelle superparamagnetiche per la loro guida ulteriormente magneticamente controllato è presentato nel protocollo corrente. L'applicazione di successo di questa strategia consente la risoluzione di alcune difficoltà di terapia cellulare, come la bassa ritenzione e poveri attecchimento nella zona lesa 2, 3, 4, realizzando un prodotto cellulare targeting p…

Divulgations

The authors have nothing to disclose.

Acknowledgements

Vorremmo ringraziare G. Fulda (Microscopia Elettronica Center, Università di Rostock, Germania) per il supporto tecnico ad acquisire immagini TEM di nanoparticelle superparamagnetiche filtrati e nello svolgimento loro analisi ai raggi X. Il lavoro svolto presso la RTC Rostock è stato sostenuto dal Ministero federale dell'Istruzione e della Ricerca Germania (FKZ 0312138A, FKZ 316159 e VIP + 03VP00241) e lo Stato Meclemburgo-Pomerania occidentale con i Fondi strutturali dell'UE (FSE / IV-WM-B34- 0030/10 e FSE / IV-BM-B35-0010 / 12) e dalla DFG (dA 1296-1), l'umidità-Fondazione, e la Heart Foundation tedesco (F / 01/12). Frank Wiekhorst è stato sostenuto dal programma di ricerca dell'UE del 7 ° PQ "NanoMag" FP7-NMP-2013-LARGE-7.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

References

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Keywords: Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/fr/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citer Cet Article
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Télécharger la Citation
Réimpressions et Autorisations

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image