MRNA Interactome Capture aus Pflanzenprotoplasten
Summary
Hier präsentieren wir ein Interaktom-Capture-Protokoll, das auf Arabidopsis thaliana Blatt-Mesophyll-Protoplasten angewendet wird. Diese Methode beruht kritisch auf in vivo UV-Vernetzung und ermöglicht die Isolierung und Identifizierung von p-mRNA-bindenden Proteinen aus einer physiologischen Umgebung.
Abstract
RNA-bindende Proteine (RBPs) bestimmen die Schicksale von RNAs. Sie beteiligen sich an allen RNA-Biogenese-Pfaden und tragen insbesondere zur posttranskriptionellen Genregulation (PTGR) von Messenger-RNAs (mRNAs) bei. In den vergangenen Jahren wurde eine Reihe von mRNA-gebundenen Proteomen aus Hefe- und Säugetierzelllinien erfolgreich durch die Verwendung einer neuartigen Methode namens "mRNA interactome capture" isoliert, die die Identifizierung von mRNA-bindenden Proteinen (mRBPs) ermöglicht, Direkt aus einer physiologischen Umgebung. Das Verfahren besteht aus in vivo- Ultraviolett- (UV-) Vernetzung, Pull-Down und Reinigung von Messenger-Ribonukleoproteinkomplexen (mRNPs) durch Oligo (dT) -Kügelchen und die anschließende Identifizierung der vernetzten Proteine durch Massenspektrometrie (MS). In jüngster Zeit wurden durch die Anwendung der gleichen Methode mehrere pflanzen-mRNA-gebundene Proteome gleichzeitig aus verschiedenen Arabidopsis- Gewebequellen berichtet: etiolierte Sämlinge, Blattgewebe,Blatt-Mesophyll-Protoplasten und kultivierten Wurzelzellen. Hier präsentieren wir die optimierte mRNA-Interaktom-Capture-Methode für Arabidopsis Thaliana- Blatt-Mesophyll-Protoplasten, ein Zelltyp, der als vielseitiges Werkzeug für Experimente dient, die verschiedene zelluläre Assays einschließen. Die Bedingungen für eine optimale Proteinausbeute umfassen die Menge an Ausgangsgewebe und die Dauer der UV-Bestrahlung. In der mRNA-gebundenen Proteom von einem mittelgroßen Experiment erhalten (10 7 Zellen), RBPs merkt RNA-Bindungskapazität zu haben , wurde gefunden , dass überrepräsentiert werden, und viele neue RBPs wurden identifiziert. Das Experiment kann skaliert werden (10 9 Zellen), und das optimierte Verfahren kann auf andere Pflanzenzelltypen und -arten angewendet werden, um mRNA-gebundene Proteome in Pflanzen weitgehend zu isolieren, zu katalogisieren und zu vergleichen.
Introduction
Eukaryonten verwenden mehrere RNA-Biogenese-regulatorischen Wege, um zelluläre biologische Prozesse aufrechtzuerhalten. Unter den bekannten Arten von RNA ist mRNA sehr vielfältig und trägt die Codierungskapazität von Proteinen und deren Isoformen 1. Der PTGR-Weg leitet das Schicksal der prä-mRNAs 2 , 3 . RBPs von verschiedenen Genfamilien kontrollieren die Regulation von RNA und in PTGR führen spezifische mRBPs mRNAs durch direkte physikalische Wechselwirkungen, die funktionelle mRNPs bilden. Daher ist die Identifizierung und Charakterisierung von mRBPs und deren mRNPs entscheidend für das Verständnis der Regulation des zellulären mRNA-Metabolismus 2. In den vergangenen drei Jahrzehnten wurden verschiedene in vitro- Methoden – einschließlich RNA-Elektrophorese-Mobilitätsverschiebungen (REMSA) -Anays, systematische Evolution von Liganden durch exponentielle Anreicherungsassays durchgeführt (SELEX) auf Basis von bibliotheksbezogenen Konstrukten, RNA Bind-n-Seq (RBNS), radioaktiv markiert oder quantitativFluoreszenz-RNA-Bindungsassays, Röntgenkristallographie und NMR-Spektroskopie 4 , 5 , 6 , 7 , 8 , 9 – wurden weitgehend auf Studien von RBPs, hauptsächlich aus Säugetierzellen, angewendet. Die Ergebnisse dieser Studien von Säugetier RBPs kann über das RNA-bindende Protein DataBase (RBPDB) gesucht werden, die die veröffentlichten Beobachtungen 10 sammelt.
Obwohl diese in vitro- Ansätze mächtige Werkzeuge sind, bestimmen sie die gebundenen RNA-Motive aus einem gegebenen RNA-Pool von Sequenzen und sind daher in ihrer Fähigkeit, neue Ziel-RNAs zu entdecken, begrenzt. Dasselbe gilt für die Rechenstrategien genomweite RBPs vorherzusagen, die zur Erhaltung der Proteinsequenz basieren und 15 strukturieren. Um dies zu überwinden, ist eine neue experimentelle Methode haS etabliert, die die Identifizierung der RNA-Motive ermöglicht, mit denen ein RBP von Interesse interagiert, sowie für die Bestimmung der genauen Lage der Bindung. Diese Methode, genannt "Vernetzung und Immunopräzipitation" (CLIP), besteht aus in vivo UV-Vernetzung, gefolgt von Immunopräzipitation 11 . Frühere Studien haben gezeigt, dass die Photoaktivierung von DNA- und RNA-Nukleotiden bei Anregungs-UV-Wellenlängen größer als 245 nm auftreten kann. Die Reaktion durch Thymidin scheint begünstigt zu sein (Rang in der Reihenfolge der verminderten Photoreaktivität: dT ≥ dC> rU> rC, dA, dG) 12 . Unter Verwendung von UV-Licht mit einer Wellenlänge von 254 nm (UV-C) wurde beobachtet, dass kovalente Bindungen zwischen RNA-Nukleotiden und Proteinresten entstehen, wenn sie im Bereich von nur wenigen Angström (Å) liegen. Das Phänomen wird daher als "Null-Länge" Vernetzung von RNA und RBP bezeichnet. Darauf folgt eine strenge Aufreinigung Dure mit wenig Hintergrund 13 , 14 .
Eine für CLIP komplementäre Strategie besteht darin, in vivo UV-Vernetzung mit Proteinidentifikation zu kombinieren, um die Landschaft von RBPs zu beschreiben. Eine Reihe solcher genomweite mRNA-gebundenen Proteome wurden aus Hefezellen, embryonale Stammzellen ( ES- Zellen) und menschlichen Zelllinien (dh, HEK293 und HeLa) unter Verwendung dieses neuen experimentellen Ansatz, genannt „mRNA Interaktom capture“ 18, isoliert 19 , 20 , 21 . Das Verfahren besteht aus in vivo UV-Vernetzung, gefolgt von mRNP-Reinigung und MS-basierter Proteomik. Durch die Anwendung dieser Strategie wurden viele neuartige "Mondlicht" -RBPs, die nicht-kanonische RBDs enthalten, entdeckt worden, und es ist klar geworden, dass mehr Proteine RNA-bindende Kapazitäten haben, als zuvor angenommen"> 15 , 16 , 17. Die Verwendung dieser Methode ermöglicht neue Anwendungen und die Möglichkeit, bei der Untersuchung von RBPs neue biologische Fragen zu beantworten. So hat beispielsweise eine aktuelle Studie die Konservierung des mRNA-gebundenen Proteoms (der Kern-RBP) untersucht Proteom) zwischen Hefe und menschlichen Zellen 22 .
Pflanze RBPs haben sich bereits in Wachstum und Entwicklung ( z . B. in der posttranskriptionalen Regulation der Blütezeit, der zirkadianen Uhr und der Genexpression in Mitochondrien und Chloroplasten) 24 , 25 , 26 , 27 , 28 , 29 beteiligt . Darüber hinaus wird angenommen, dass sie Funktionen in den zellularen Prozessen ausführen, die auf abiotische Belastungen reagieren ( zB Kälte, Dürre, SaLinität und Abszisäure (ABA)) 31 , 32 , 33 , 34 . Es gibt mehr als 200 vorhergesagte RBP-Gene im Arabidopsis-Thaliana- Genom, basierend auf RNA-Erkennungsmotiv (RRM) und K-Homologie (KH) Domänensequenzmotiven; In Reis wurden etwa 250 bekannt, 35 , 36 . Es ist bemerkenswert, dass viele vorhergesagte RBPs für Pflanzen einzigartig zu sein scheinen ( z. B. keine Metazoan-Orthologe zu etwa 50% der vorhergesagten Arabidopsis- RBPs, die eine RRM-Domäne enthalten) 35 , was darauf hindeutet, dass viele neue Funktionen erfüllen können. Die Funktionen der meisten vorhergesagten RBPs bleiben uncharakterisiert 23 .
Die Isolierung von mRNA-gebundenen Proteomen aus Arabidopsis etiolierten Sämlinge, Blattgewebe, kultivierte Wurzelzellen und Blatt-Mesophyll-Protoplasten durch den Einsatz vonMRNA-Interaktom-Capture wurde vor kurzem berichtet 38 , 39 . Diese Studien zeigen das starke Potenzial der systematischen Katalogisierung von funktionalen RBPs in Anlagen in naher Zukunft. Hier stellen wir ein Protokoll für die mRNA-Interaktom-Erfassung von Pflanzenprotoplasten ( dh Zellen ohne Zellwände) vor. Arabidopsis Thaliana Blatt Mesophyll Protoplasten sind die wichtigsten Arten von Blatt Zelle. Die isolierten Protoplasten ermöglichen einen optimalen Zugang von UV-Licht zu den Zellen. Dieser Zelltyp kann in Assays verwendet werden, die vorübergehend Proteine für die funktionelle Charakterisierung 40 , 41 exprimieren. Weiterhin wurde das Protoplasten auf mehrere andere Pflanzenzelltypen und Arten 42 , 43 , 44 angewendet ( z. B. Petersson et al ., 2009, Bargmann und Birnbaum, 2010 und Hong et al ., 2012).
<P class = "jove_content"> Die Methode umfasst insgesamt 11 Schritte ( Abbildung 1A ). Arabidopsis- Blatt-Mesophyll-Protoplasten werden zuerst isoliert (Schritt 1) und werden anschließend UV-bestrahlt, um vernetzte mRNPs zu bilden (Schritt 2). Wenn die Protoplasten unter denaturierenden Bedingungen lysiert werden (Schritt 3), werden die vernetzten mRNPs in Lyse / Bindungspuffer freigesetzt und durch Oligo-d (T) 25- Kügelchen (Schritt 4) heruntergezogen. Nach mehreren Runden von stringenten Waschungen werden die mRNPs gereinigt und weiter analysiert. Die denaturierten Peptide von mRBPs werden durch Proteinase K verdaut, bevor die vernetzten mRNAs gereinigt werden und die RNA-Qualität durch qRT-PCR (Schritte 5 und 6) verifiziert wird. Nach der RNase-Behandlung und der Proteinkonzentration (Schritt 7) wird die Proteinqualität durch SDS-Polyacrylamidgelelektrophorese (SDS-PAGE) und Silberfärbung gesteuert (Schritt 8). Der Unterschied in Proteinbandmustern kann leicht zwischen einer vernetzten Probe (CL) und einer nicht vernetzten Probe (nicht-CL;Die Negativkontrollprobe aus Protoplasten, die keiner UV-Bestrahlung ausgesetzt ist). Die Identifizierung von Proteinen wird durch MS-basierte Proteomik erreicht. Die Proteine aus der CL-Probe werden durch eine eindimensionale Polyacrylamid-Gelelektrophorese (1D-PAGE) getrennt, um mögliche Hintergrundverunreinigungen zu entfernen, werden unter Verwendung von Trypsin "in-Gel-verdaut" in kurze Peptide und werden gereinigt (Schritt 9). Nano-Reverse-Phase-Flüssigkeitschromatographie, gekoppelt an Massenspektrometrie (Nano-LC-MS) ermöglicht die Bestimmung der Menge an definitiven Proteinen im mRNA-gebundenen Proteom (Schritt 10). Schließlich werden die identifizierten mRBPs unter Verwendung einer bioinformatischen Analyse charakterisiert und katalogisiert (Schritt 11).Protocol
Representative Results
Discussion
Wir haben mRNA-Interaktom-Capture, die für Hefe und menschliche Zellen entwickelt wurden, erfolgreich angewendet, um Blatt-Mesophyll-Protoplasten zu pflanzen. Blatt-Mesophyll-Zellen sind die Hauptart des Grundgewebes in Pflanzenblättern. Der Hauptvorteil dieser Methode ist, dass sie in vivo Vernetzung verwendet, um die Proteine aus einer physiologischen Umgebung zu entdecken.
In diesem Protokoll stellen wir vor allem eine Reihe von optimierten experimentellen Bedingungen vor…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Wir bestätigen das Labor von Prof. Joris Winderickx, der die UV-Vernetzungsapparatur mit der konventionellen UV-Lampe ausgestattet hat. KG wird vom KU Leuven Research Fund unterstützt und erkennt die Unterstützung von FWO Grant G065713N an.
Materials
| REAGENTS | |||
| 0.8 M Mannitol | Sigma | M1902-500G | Primary isotonic Enzyme solution & MMg solution |
| 2M KCl | MERCK | Art. 4935 | Primary isotonic Enzyme solution & W5 buffer |
| 0.2 M MES (pH 5.7) (4-morpholineethanesulfonic acid) |
Sigma-aldrich | M2933 | Primary isotonic Enzyme solution, W5 buffer & MMg solution, Filtration sterilization |
| Cellulase R10 | Yakult Pharmaceutical Industry Co., Ltd. | CELLULASE “ONOZUKA” R-10, 10 g |
Final isotonic enzyme solution |
| Macerozyme R10 | Yakult Pharmaceutical Industry Co., Ltd. | MACEROZYME R-10, 10g | Final isotonic enzyme solution |
| 10% (w/v) BSA (Bovine Serum Albumin) |
Sigma-aldrich | A7906-100G | Final isotonic enzyme solution & Filtration sterilization |
| 1M CaCl2 | Chem-Lab NV | CL00.0317.1000 | Final isotonic enzyme solution, W5 buffer & Digestion buffer |
| 1M NaCl | Fisher Chemical | S/3160/60 | W5 buffer |
| 2M MgCl2 | Sigma | M8266-100G | MMg solution |
| 1M LiCl (Lithium Chloride) |
Acros | 199885000 | Lysis/binding buffer, Wash buffer 1, Wash buffer 2 & Low salt buffer |
| 5% (w/v) LiDS (Lithium Dodecyl Sulphate) |
Sigma-aldrich | L4632-25G | Lysis/binding buffer, Wash buffer 1 & Filtration sterilization |
| 1M DTT (Dithiothreitol) |
Thermo Fisher Scientific Wash buffer 1 & Wash buffer 2 |
307866 | Lysis/binding buffer, |
| 1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) | Acros & Fisher Chemical |
167620010 & H/1200/PB15 |
Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| 0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) | Sigma-aldrich | ED-500G | Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer |
| Tween 20 | MERCK | 8.22184.0500 | Regeneration of oligo-d(T)25 beads |
| 0.1 M NaOH | VWR PROLABO CHEMICALS | 28244.295 | Regeneration of oligo-d(T)25 beads |
| 1X PBS (pH 7.4) (Phosphate Buffered Saline) containing (NaCl; KCl; Na2HPO4; KH2PO4) |
Fisher Chemical, MERCK, Sigma-aldrich & SAFC |
S/3160/60, Art. 4935, 71640-250G & 60230 |
Regeneration of oligo-d(T)25 beads |
| Proteinase K solution (2 μg/μL) | Thermo Fisher Scientific | 11789020 | Protein digestion |
| Loading dye | Invitrogen | LC5925 | SDS-PAGE |
| qPCR master mix | Promega | A6001 | qRT-PCR assay |
| RNase Cocktail | Thermo Fisher Scientific | AM2286 | RNA digestion |
| Methanol | Sigma-aldrich | 322415 | Gel fixation and gel destaining |
| Acetic acid | Sigma-aldrich | 537020 | Gel fixation and gel destaining |
| Coomassie Brilliant Blue R-250 | Thermo Fisher Scientific | 20278 | Gel staining |
| 1M NH4HCO3 (Ammonium bicarbonate) |
Sigma-aldrich | 09830-500G | Gel hydration & Digestion buffer |
| CH3CN (Acetonitrile) |
Sigma-aldrich | 34851-100ML | Gel dehydration & Peptide dissolving solution |
| IAA (Iodoacetic acid) |
Sigma-aldrich | I4386-10G | Alkylating agent |
| TFA (Trifluoroacetic acid) |
Sigma-aldrich | 302031-10X1ML | Peptide dissolving solution |
| FA (Formic acid) |
Sigma-aldrich | 06554-5G | Peptide extraction |
| Trypsin solution (6 ng/μL) | Promega | V5280 | Digestion buffer |
| Name | Company | Catalog Number | Comments |
| EQUIPMENT | |||
| Soil | Peltracom | LP2D | Plant growth |
| Vermiculite 3 | Sibli AS | 05VERMICULIET | Plant growth |
| Petri dish (150 x 20 mm) | Sarstedt | 82.1184.500 | Carrier for protoplast suspension |
| 0.22 μm filter | Millipore | SE2M229104 | Homogenization of final isotonic enzyme solution |
| Razorblade | Agar Scientific | T585 | Rosette leaf strips |
| 35-75 μm nylon mesh | SEFAR NITEX | 74010 | Protoplast suspension filtration |
| 50 mL round bottom tubes | Sigma-aldrich | T1918-10EA | Carrier for protoplast suspension |
| Hemocytometer (Bürker hemocytometer) |
MARIENFELD | 650030 | Protoplast cell counting |
| UV crosslinking apparatus (HL-2000 HybriLinker) |
UVP, LLC | UVP95003101 | in vivo UV crosslinking |
| UV lamp (Sankyo-Denki G8T5) |
SANKYO DENKI |
SD G8T5 | in vivo UV crosslinking |
| 50 mL glass syringe | FORTUNA Optima | Z314560 | Homogenization of protoplast lysate |
| Narrow needle (0.9 x 25 mm) | Becton Dickinson microlance 3 | 2021-04 | Homogenization of protoplast lysate |
| Rotator Model L26 | Labinco BV | 26110912 | Sample incubation by rotating |
| Oligo-d(T)25 magnetic beads (5 mg/mL) |
New England BioLabs | S1419S | mRNPs and mRNAs binding and pull-down |
| Magnetic rack | Invitrogen | CS15000 | mRNPs and mRNAs binding and pull-down |
| Centrifugal filter units (Amicon Ultra-4 centrifugal filter units) |
EMD Millipore | UFC800308 | mRBP concentration |
| Pierce Silver Stain Kit | Thermo Fisher Scientific | 24612 | Silver-staining assay |
| RNA purification kit (InviTrap Spin Plant RNA Mini Kit) |
STRATEC Molecular | 1064100300 | RNA purification |
| Spectrophotometer device (NanoDrop 1000 Spectrophotometer) | Thermo Fisher Scientific | ND-1000 | RNA quality and quantity |
| Real-Time PCR cycler (StepOne Real-Time PCR cycler) |
Thermo Fisher Scientific | 4376600 | cDNA quantification |
| µ-C18 columns (Millipore Zip Tip µ-C18 columns) |
Sigma-aldrich | 720046-960EA | Peptide purification |
| Mass spectrometer (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer) |
Thermo Fisher Scientific | IQLAAEGAAPFALGMAZR | Mass spectrometry-based proteomics |
| Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) | Thermo Fisher Scientific | ULTIM3000RSLCNANO | Mass spectrometry-based proteomics |
| C18 column (Easy Spray Pepmap RSLC C18 column) |
Thermo Fisher Scientific | ES800 | Mass spectrometry-based proteomics |
| C18 precolumn (Acclaim Pepmap 100 C18 precolumn) |
Thermo Fisher Scientific | 160321 | Mass spectrometry-based proteomics |
| Name | Company | Catalog Number | Comments |
| Primers for qRT-PCR assay | Sequences | ||
| UBQ10 mRNA (Li et al., 2014) |
Fw: AACTTTGGTGGTTTGTGTTTTGG Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA |
||
| 18S rRNA (Durut et al., 2014) |
Fw: CGTAGTTGAACCTTGGGATG Rv: CACGACCCGGCCAATTA |
||
References
- Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16 (9), 533-544 (2015).
- Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582 (14), 1977-1986 (2008).
- Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15 (12), 829-845 (2014).
- Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272 (43), 27274-27280 (1997).
- Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98 (6), 835-845 (1999).
- Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280 (15), 15340-15347 (2005).
- Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33 (22), 7074-7089 (2005).
- Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105 (40), 15317-15322 (2008).
- Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54 (5), 887-900 (2014).
- Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, D301-D308 (2011).
- Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13 (2), 77-83 (2012).
- Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261 (8), 3512-3518 (1986).
- Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16 (9), 323-326 (1991).
- Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8 (3), 491-500 (2013).
- Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270 (6), 2755-2763 (1995).
- Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35 (8), 423-426 (2010).
- Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39 (8), 674-679 (2012).
- Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46 (5), 674-690 (2012).
- Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149 (6), 1393-1406 (2012).
- Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20 (9), 1122-1130 (2013).
- Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20 (1), 127-133 (2013).
- Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6 (10127), 1-9 (2015).
- Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14 (8), 443-453 (2009).
- Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22 (12), 3142-3152 (2003).
- Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16 (3), 731-740 (2004).
- Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18 (2), 203-213 (2010).
- Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
- Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9 (3), e1002986 (2013).
- Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356 (1415), 1755-1759 (2001).
- Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77 (22), 7265-7273 (2005).
- Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56 (421), 3007-3016 (2005).
- Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224 (4), 900-914 (2006).
- Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59 (3), 633-644 (2008).
- Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29 (1), 125-134 (2011).
- Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 (3), 623-635 (2002).
- Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
- Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77 (4), 964-973 (2005).
- Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6 (29766), 1-13 (2016).
- Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28 (10), 2435-2452 (2016).
- Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2 (7), 1565-1572 (2007).
- Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
- Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21 (6), 1659-1668 (2009).
- Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
- Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55 (5), 390-397 (2012).
- Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7 (3), 570-572 (2014).
- Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26 (3), 1330-1344 (2014).
- Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3 (3), 697-716 (2005).
- Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10 (7), 2930-2936 (2011).
- Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11 (4), 010587 (2012).
- Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12 (42), 1-12 (2016).
- Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25 (7), 864-876 (2015).
- Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21 (3), 163-182 (2002).
- Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7 (458), 1-13 (2011).
- Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5 (11), 976-989 (1994).
- Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20 (18), 3551-3567 (1999).
