We present a protocol for the functional assessment of comprehensive single-site saturation mutagenesis libraries of proteins utilizing high-throughput sequencing. Importantly, this approach uses orthogonal primer pairs to multiplex library construction and sequencing. Representative results using TEM-1 β-lactamase selected at a clinically relevant dosage of ampicillin are provided.
Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 β-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to β-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.
Mutagenesis has long been employed in the laboratory to study the properties of biological systems and their evolution, and to produce mutant proteins or organisms with enhanced or novel functions. While early approaches relied on methods which produce random mutations in organisms, the advent of recombinant DNA technology enabled researchers to introduce select changes to DNA in a site-specific manner, i.e., site-directed mutagenesis1,2. With current techniques, typically using mutagenic oligonucleotides in a polymerase chain reaction (PCR), it is relatively facile to create and assess small numbers of mutations (e.g., point mutations) in a given gene3,4. It is far more difficult however when the goal approaches, for example, the creation and assessment of all possible single-site (or higher-order) mutations.
While much has been learned from early studies attempting to assess large numbers of mutations in genes, the techniques used were often laborious, for example requiring the assessment of each mutation independently using nonsense suppressor strains5-7, or were limited in their quantitative ability due to the low sequencing depth of Sanger sequencing8. The techniques used in these studies have largely been supplanted by methods utilizing high-throughput sequencing technology9-12. These conceptually simple approaches entail creating a library comprising a large number of mutations, subjecting the library to a screen or selection for function, and then deep-sequencing (i.e., on the order of >106 sequencing reads) the library obtained before and after selection. In this way, the phenotypic or fitness effects of a large number of mutations, represented as the change in population frequency of each mutant, can be assessed simultaneously and more quantitatively.
We previously introduced a simple approach for assessing libraries of all possible single amino acid mutations in proteins (i.e., whole-protein saturation mutagenesis libraries), applicable to genes with a length longer than the sequencing read length11,13: First, each amino acid position is randomized by site-directed mutagenic PCR. During this process, the gene is split into groups composed of contiguous positions with a total length accommodated by the sequencing platform. The mutagenic PCR products for each group are then combined, and each group independently subjected to selection and high-throughput sequencing. By maintaining a correspondence between the location of mutations in the sequence and the sequencing read length, this approach has the advantage of maximizing sequencing depth: while one could simply sequence such libraries in short windows without splitting into groups (e.g., by a standard shotgun sequencing approach), most reads obtained would be wild-type and thus the majority of sequencing throughput wasted (e.g., for a whole-protein saturation mutagenesis library of a 500 amino acid protein sequenced in 100 amino acid (300 bp) windows, at minimum 80% of reads will be the wild-type sequence).
Here, a protocol is presented which utilizes high-throughput sequencing for the functional assessment of whole-protein saturation mutagenesis libraries, using the above approach (outlined in Figure 1). Importantly, we introduce the usage of orthogonal primers in the library cloning process to barcode each sequence group, which allows them to be multiplexed into one library, subjected simultaneously to screening or selection, and then de-multiplexed for deep sequencing. Since the sequence groups are not subjected to selection independently, this reduces the workload and ensures that each mutation experiences the same level of selection. TEM-1 β-lactamase, an enzyme which confers high-level resistance to β-lactam antibiotics (e.g., ampicillin) in bacteria is used as a model system14-16. A protocol is described for the assessment of a whole-protein saturation mutagenesis library of TEM-1 in E. coli under selection at an approximate serum level for a clinical dose of ampicillin (50 µg/ml)17,18.
Note: See Figure 1 for outline of protocol. Several steps and reagents in the protocol require safety measures (indicated with "CAUTION"). Consult material safety data sheets before use. All protocol steps are performed at RT unless other indicated.
1. Prepare Culture Media and Plates
2. Construction of the Whole-gene Saturation Mutagenesis Library
Note: Primers; completed PCRs, restriction digests and ligations; and purified DNA samples can be stored at -20 °C.
3. Selection of the TEM-1 Whole-protein Saturation Mutagenesis Library for Antibiotic Resistance
4. High-throughput Sequencing to Determine the Fitness Effects of Mutations
The plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites (pBR322_OP1 – pBR322_OP5) is shown in Figure 2A. To test whether the orthogonal primers are specific, PCRs were performed using each pair of orthogonal primers individually, along with all five pBR322_OP1-5 plasmids, or with all plasmids minus the plasmid matching the orthogonal primer pair. The correct product was only obtained when the matching plasmid was included, and no product of any size was obtained in its absence (Figure 2B).
A representative experiment was performed following the protocol described in this text (Figure 1). Following processing (protocol section 4.2), 6.2 × 106 reads from the pre-selection condition and 6.3 × 106 reads from the 50 µg/ml ampicillin selection condition were obtained. The counts obtained for each amino acid mutation from the pre-selection condition display a characteristic log-normal distribution (Figure 3A)13. At least one count from sequencing of the pre-selection culture for 98.9% of mutations (58 had no counts), and greater than 100 counts for 91.2% (465 had less than 100 counts) were obtained. Figure 3B depicts the relative fitness effect () for each mutation at each position of TEM-1; the distribution of is shown in Figure 3C. Under selection at 50 µg/ml ampicillin, most mutations have a neutral or nearly-neutral fitness effect (≈ 0, corresponding to white pixels in Figure 3B and the large peak in Figure 3C). A small fraction of mutations at this concentration have substantial effects on fitness (<< 0, corresponding to blue pixels in Figure 3B and the left tail in Figure 3C); expectedly, these include mutations within the highly conserved active site residues (S70, K73, S130, D131, N132, K234 and G236)13,14. In contrast, few mutations considerably increase fitness over that of TEM-1 (>> 0, corresponding to red pixels in Figure 3B), as might be expected since TEM-1 is highly efficient at ampicillin hydrolysis ( ≈ 107 M-1s-1)14.
Figure 1. Outline of Whole-protein Saturation Mutagenesis Protocol for TEM-1 β-lactamase under Ampicillin Selection. Actions as described in the protocol are shown in bold. Numbered protocol steps are shown at left, for reference to the main text. Please click here to view a larger version of this figure.
Figure 2. Validation of Orthogonal Priming Site Plasmid Vectors. (A) Plasmid map for the five modified pBR322 plasmids containing orthogonal priming sites (pBR322_OP1 – pBR322_OP5). Location and direction of the orthogonal priming sites are indicated. Locations of several restriction sites are labeled; the TEM-1 whole-protein saturation mutagenesis library (which includes the entire TEM-1 gene and promoter) is cloned in-between the AatII and AvrII restriction sites. Abbreviations: tet tetracycline resistance gene, ori origin of replication. (B) Each pair of orthogonal primers (OP1-OP5) was tested in a PCR containing all five pBR322_OP1-5 plasmids (+), or with all plasmids minus the respective plasmid (˗). Shown is an ethidium bromide stained agarose gel (1% w/v) loaded with each PCR reaction, size separated by electrophoresis. The expected size product is 1,628 bp; the first lane is a DNA ladder, sizes of relevant standards are indicated. Please click here to view a larger version of this figure.
Figure 3. Results of TEM-1 β-lactamase Whole-protein Saturation Experiment. (A) Histogram showing the distribution of counts for each amino acid mutation obtained from high-throughput sequencing of the library from the pre-selection condition. For simplicity, mutations with zero counts (53 mutations) are shown as having a count of one. (B) Fitness effects of all single amino acid mutations in TEM-1 under selection at 50 µg/ml ampicillin. Shown is the data matrix containing the relative fitness effect () depicted colorimetrically with blue representing deleterious effect, red a positive effect and white no fitness effect relative to wild-type. Mutations for which no counts were obtained from the pre-selection culture are colored black. Rows depict positions along the primary sequence and columns indicate mutation to one of twenty amino acids or stop codon (indicated by one-letter code, * is stop codon); the secondary structure of TEM-1 is indicated at left and several highly conserved motifs within the active site are indicated at right. (C) Histogram showing the distribution of relative fitness effects. Shown are results for those mutations with >100 counts obtained from sequencing the pre-selection culture. Please click here to view a larger version of this figure.
Reagent | Mass or Volume | Comment |
Typtone | 2 g | |
Yeast extract | 0.5 g | |
Sodium chloride | 0.06 g | |
Potassium chloride | 0.02 g | |
Magnesium sulfate | 0.24 g | |
Purified water | 100 ml |
Table 1. Super Optimal Broth (SOB). Reagent names and quantities used in preparing 100 ml SOB (Protocol step 1.1).
Reagent | Mass or Volume | Comment |
Typtone | 10 g | |
Yeast extract | 5 g | |
Sodium chloride | 10 g | |
Purified water | 1 L |
Table 2. Luria-Bertani Broth (LB). Reagent names and quantities used in preparing 1 L LB (protocol step 1.1).
Reagent | Mass or Volume | Comment |
Typtone | 10 g | |
Yeast extract | 5 g | |
Sodium chloride | 10 g | |
Agar | 15 g | |
Purified water | 1 L |
Table 3. LB-agar. Reagent names and quantities used in preparing LB-agar (protocol step 1.1).
Reagent | Volume | Comment |
5x PCR buffer | 1,450 µl | |
PCR additive | 1,450 µl | |
2 mM dNTPs | 725 µl | 2 mM each nucleotide |
50 µM AatII_F or AvrII_R primer | 145 µl | |
1 ng/µl pBR322_AvrII plasmid | 145 µl | |
2 units/µl DNA polymerase | 72.5 µl | |
water | 363 µl |
Table 4. First-round Mutagenic PCR Master Mix. Reagent names and quantities for preparing the master mix for the first-round mutagenic PCR (protocol step 2.2.1). Total quantity is sufficient for 290 25 µL reactions.
Reagent | Volume | Comment |
5x PCR buffer | 1,450 µl | |
PCR additive | 1,450 µl | |
2 mM dNTPs | 725 µl | 2 mM each nucleotide |
50 µM AatII_F primer | 145 µl | |
50 µM AvrII_R primer | 145 µl | |
2 units/µl DNA polymerase | 72.5 µl | |
water | 2,973 µl |
Table 5. Second-round Mutagenic PCR Master Mix. Reagent names and quantities for preparing the master mix for the second-round mutagenic PCR (protocol step 2.2.2). Total quantity is sufficient for 290 25 µl reactions.
Reagent | Volume | Comment |
5x PCR buffer | 20 µl | |
PCR additive | 20 µl | |
2 mM dNTPs | 10 µl | 2 mM each nucleotide |
50 µM AvrII_F primer | 2 µl | |
50 µM AatII_OP1_R – AatII_OP5_R primer | 2 µl | one primer per reaction, paired with respective plasmid |
1 ng/µl pBR322_OP1-5 plasmid | 2 µl | one plasmid per reaction |
2 units/µl DNA polymerase | 1 µl | |
water | 43 µl |
Table 6. Cloning Vector PCR. Reagent names and quantities for preparing the PCR to make the cloning vectors (protocol step 2.3.2).
Reagent | Volume | Comment |
10x restriction enzyme buffer | 5 µl | |
4 units/µl AvrII | 2.5 µl | |
20 units/µl AatII | 0.5 µl | |
DNA to restriction digest | volume for 500 ng | |
water | to 50 µl total volume |
Table 7. Restriction Digests. Reagent names and quantities for restriction digests of cloning vectors and NNS sub-library groups (protocol step 2.3.3).
Reagent | Volume | Comment |
10x T4 DNA ligase buffer | 5 µl | |
purified restriction-digested NNS sub-library group DNA | volume for 48 ng | |
purified restriction-digested cloning vector DNA | volume for 52 ng | |
400 units/µl T4 DNA ligase | 1 µl | |
water | to 20 µl total volume |
Table 8. Ligations. Reagent names and quantities for ligations of cloning vectors with restriction-digested NNS sub-library groups in a 1:3 vector:insert molar ratio (protocol step 2.3.4).
Reagent | Volume | Comment |
5x PCR buffer | 55 µl | |
PCR additive | 55 µl | |
2 mM dNTPs | 27.5 µl | 2 mM each nucleotide |
2 units/µl DNA polymerase | 2.75 µl | |
water | 113 µl |
Table 9. PCR Reagents for Preparing Samples for High-throughput Sequencing. Reagent names and quantities for preparing PCR master mixes used for de-multiplexing with orthogonal primers (4.1.1), isolating NNS sub-library groups (protocol step 4.1.2) and adding indexing sequences (protocol step 4.1.3). Total quantity is sufficient for 11 25 µl reactions.
Here a protocol is described for performing the functional assessment of whole-protein saturation mutagenesis libraries, using high-throughput sequencing technology. An important aspect of the method is the use of orthogonal primers during the cloning process. Briefly, each amino acid position is randomized by mutagenic PCR, and mixed together into groups of positions whose combined sequence length is accommodated by high-throughput sequencing. These groups are cloned into plasmid vectors containing pairs of orthogonal priming sites, mixed together and subjected to selection, then de-multiplexed using the orthogonal primers, and subsequently deep sequenced. Since mutations are confined within the sequencing read length limit, this approach maximizes the number of useful reads containing mutations for genes of size longer than the sequencing read length. In addition, this technique allows for the simultaneous or "one-batch" selection of the entire mutational library, reducing the workload as well as the possibility that mutations experience different levels of selection. Practically, the critical steps in the protocol largely concern organization: during the cloning process (protocol step 2.3) one must ensure the correct mixing of mutagenic PCR products into groups and their subsequent cloning into the correct orthogonal priming site vector; during the preparation of the sample for sequencing (protocol step 4.1), the correct orthogonal primers, as well as primers to isolate each of the NNS sub-library groups and add indexing sequences, must be used.
The three main steps of the protocol – library construction, selection, and sequencing – can be modified in several aspects. During library construction one could introduce mutations using a variety of techniques, for example, by error-prone PCR, or by constructing the gene using oligonucleotides synthesized by doping in a small fraction of alternative nucleotides21. One could construct the library to include double or higher-order mutations within segments of the protein (i.e., NNS sub-library groups), or in alternate genotype backgrounds22. Importantly, all modifications to the library construction step however should satisfy the criterion that the correspondence between the location of mutations in the sequence and the sequencing read length is maintained. This criterion therefore excludes the application of the protocol towards comprehensive studies of multiple mutations across a protein. Modifications to the second part of the protocol include alternate selection conditions: different β-lactam types (or combinations) and concentrations, external stress conditions (e.g., temperature, nutrient levels), host type (e.g., different types of bacteria), or different sampling times (hours to days). For example, in previous work we examined the fitness effects of all single amino acid mutations in TEM-1 under different concentrations of ampicillin, and under the third-generation cephalosporin cefotaxime13. With regards to the third step of the protocol, we currently do not recommend deviating from the choice of the sequencing platform used here (see Table of Materials). While sequencing read lengths are indeed currently longer in other platforms, the number of reads obtainable is currently far lower; in general the accuracy to which the effect of a mutation can be determined is proportional to the number of reads obtained (see equation in protocol step 4.2.5).
Largely for simplicity, the protocol uses TEM-1 β-lactamase as a model system, however the methodology described here can be extended to other systems for which a high-throughput selection or screening assay is in place. Constructing such assays is however often non-trivial: First, a strategy for compartmentalization of gene (mutation) and protein together must be established, for example within a cell, liquid droplet (as in a microfluidics platform), or by phage display. Second, and most importantly, a quantitative connection between protein function and a selectable phenotype, or fitness, must be established. For enzymes involved in metabolism or antibiotic resistance, the ability of cells to grow in nutrient drop-out or antibiotic media is often a direct function of enzymatic activity. A more synthetic approach could be used in other systems, for example by linking protein-protein binding affinity to reporter gene (e.g., fluorescent protein) expression in bacteria or yeast11,23, or using a fluorogenic enzyme substrate in a microfluidics system24. Lastly, such an assay must be scalable, to address the size of a whole-protein mutagenesis library.
In summary, a high-throughput sequencing-based approach for the functional assessment of whole-protein saturation mutagenesis libraries is described here. Central to the approach is the construction of the mutagenesis library within segments along the gene, and the utilization of orthogonal primer barcodes to tag each segment for multiplexing and de-multiplexing the library. We anticipate that this protocol could be readily applied to other proteins for which an appropriate high-throughput selection or screen has been developed.
The authors have nothing to disclose.
R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.
Typtone | Research Products Intl. Corp. | T60060-1000.0 | |
Yeast extract | Research Products Intl. Corp. | Y20020-500.0 | |
Sodium chloride | Fisher Scientific | BP358-212 | |
Potassium chloride | Sigma-Aldrich | P9333-500G | |
Magnesium sulfate | Sigma-Aldrich | M7506-500G | |
Agar | Fisher Scientific | BP1423-500 | |
Tetracycline hydrochloride | Sigma-Aldrich | T7660-5G | |
petri plates | Corning | 351029 | |
MATLAB | Mathworks | http://www.mathworks.com/products/matlab/ | |
Oligonucleotide primers | Integrated DNA Technologies | https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos | 25 nmol scale, standard desalting |
pBR322_AvrII | available upon request | pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene | |
pBR322_OP1 – pBR322_OP5 | available upon request | five modified pBR322 plasmids each containing a pair of orthogonal priming sites | |
Q5 high-fidelity DNA polymerase | New England Biolabs | M0491L | includes 5X PCR buffer and PCR additive (GC enhancer) |
15 mL conical tube | Corning | 430025 | |
Multichannel pipettes (Eppendorf ResearchPlus) | Eppendorf | ||
PCR plate, 96 well | Fisher Scientific | 14230232 | |
96 well plate seal | Excel Scientific | F-96-100 | |
Veriti 96-well thermal cycler | Applied Biosystems | 4375786 | |
6X gel loading dye | New England Biolabs | B7024S | |
Agarose | Research Products Intl. Corp. | 20090-500.0 | |
Ethidium bromide | Bio-Rad | 161-0433 | |
UV transilluminator (FOTO/Analyst ImageTech) | Fotodyne Inc. | http://www.fotodyne.com/content/ImageTech_gel_documentation | |
EB buffer | Qiagen | 19086 | |
96-well black-walled, clear bottom assay plates | Corning | 3651 | |
Lambda phage DNA | New England Biolabs | N3011S | |
PicoGreen dsDNA reagent | Invitrogen | P7581 | dsDNA quantitation reagent, used in protocol step 2.2.4 |
Victor 3V microplate reader | PerkinElmer | ||
DNA purification kit | Zymo Research | D4003 | |
Microcentrifuge tubes | Corning | 3621 | |
Long-wavelength UV illuminator | Fisher Scientific | FBUVLS-80 | |
Agarose gel DNA extraction buffer | Zymo Research | D4001-1-100 | |
AatII | New England Biolabs | R0117S | |
AvrII | New England Biolabs | R0174L | |
T4 DNA ligase | New England Biolabs | M0202S | |
EVB100 electrocompetent E. coli | Avidity | EVB100 | |
Electroporator (E. coli Pulser) | Bio-Rad | 1652102 | |
Electroporation cuvettes | Bio-Rad | 165-2089 | |
Spectrophotometer (Ultrospec 3100 pro) | Amersham Biosciences | 80211237 | |
50 mL conical tubes | Corning | 430828 | |
Plasmid purification kit | Macherey-Nagel | 740588.25 | |
8 well PCR strip tubes | Axygen | 321-10-551 | |
Qubit dsDNA HS assay kit | Invitrogen | Q32854 | dsDNA quantitation reagent |
Qubit assay tubes | Invitrogen | Q32856 | |
Qubit fluorometer | Invitrogen | Q32866 | |
Ampicillin sodium salt | Akron Biotechnology | 50824296 | |
MiSeq reagent kit v2 (500 cycles) | Illumina | MS-102-2003 | |
MiSeq desktop sequencer | Illumina | http://www.illumina.com/systems/miseq.html | alternatively, one could sequence on Illumina HiSeq platform |
FLASh software | John Hopkins University – open source | http://ccb.jhu.edu/software/FLASH/ | software to merge paired-end reads from next-generation sequencing data |
AatII_F | GATAATAATGGTTTCTTAGACGTCAGGTGGC | ||
AvrII_R | CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG | ||
AvrII_F | CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG | ||
AatII_OP1_R | ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC | ||
AatII_OP2_R | ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC | ||
AatII_OP3_R | ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC | ||
AatII_OP4_R | ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC | ||
AatII_OP5_R | ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC | ||
OP1_F | GACCGGACAGTTGAAATACG | ||
OP1_R | CGACGTACAGGACAATTTCC | ||
OP2_F | ATTAGTACACTCCGTGAGCG | ||
OP2_R | AGTATTAGGCGTCAAGGTCC | ||
OP3_F | AGTCCCAAGTTCAGACGTAC | ||
OP3_R | GAAAAGTCCCAATGAGTGCC | ||
OP4_F | TCACTTGGTATCGAGAACGG | ||
OP4_R | TATCACGGAAGGACTCAACG | ||
OP5_F | AGATTGTTACTCCGACGGAC | ||
OP5_R | TATAACAGGCTGCTGAGACC | ||
Group1_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC | ||
Group1_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC | ||
Group2_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC | ||
Group2_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG | ||
Group3_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC | ||
Group3_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC | ||
Group4_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC | ||
Group4_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC | ||
Group5_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC | ||
Group5_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG | ||
501_F | AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC | ||
502_F | AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC | ||
503_F | AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC | ||
504_F | AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC | ||
505_F | AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC | ||
701_R | CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG | ||
702_R | CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG |