אינדוקציה של הפעלה האימהית חיסונית בעכברים בשלב אמצע הריון עם ויראלי לחקות פולי (אני: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
הרעיון של הפעלת החיסון האמהית (MIA) מקורו מחקרים באפידמיולוגיה על הקשר בין זיהום אימהי עם אוטיזם וסכיזופרניה 1. בשל העדר של פתוגנים ויראליים שכפול לגילוי בשליה או במוח העוברי לאחר זיהום ויראלי אימהי 2,3, השפעת הזיהום על הצאצאים משערת להיגרם על ידי הפעלת המערכת האימהית החיסון ולא פתוגנים עצמם .
כדי להבהיר את היחס אפקט-ו-הגורם בין MIA והפרעות פסיכיאטריות, הזרקת מסונתז כימית, polyinosinic גדילי RNA כפול ויראלי לחקות: חומצה polycytidylic (פולי (אני: C)) לתוך מכרסמים בהריון כבר בשימוש נרחב כמו במודל חיה עבור MIA 4,5. פולי (אני: C) הוא מוכר על ידי קולטן לחיוג כמו 3 (TLR3), ומנהל מערכתי של פולי (אני: C) גורם לתגובה דלקתית חריפה ויראלי דמוי. אחד המנגנונים שבאמצעותם פולי (אני: C) יחסי ציבורליקויי neuropathologies התנהגותי oduces אצל צאצאיהם הם לגרום לחוסר איזון של ציטוקינים דלקתיים פרו ואנטי בציר האימהי-שליה-העוברי 6. כמה קבוצות אימצו את המודל MIA להבין את האטיולוגיה של הפרעות פסיכיאטריות 7, ובשל אינטרסים מגוונים בקרב קבוצות מחקר, בנקודות זמן שונות של הפעלה חיסונית שימשו להשיג הפרעות שונות על התפתחות המוח והתנהגויות 7.
המעבדה פול ה פטרסון במכון הטכנולוגי של קליפורניה מאמצת את האסטרטגיה של הזרקת פולי (אני: C) לעכברים בהריון עובריים 12.5 ימים (E12.5), אשר הוכיחה בהצלחה כי MIA הוא מסוגל גרימת התנהגותי, נוירולוגיות, ושינויים אימונולוגיים אצל צאצאיהם המשויכים אוטיזם וסכיזופרניה 8-11. העבודות הקודמות שלנו מראות כי צאצאי MIA להציג ליקויים התנהגותיים (למשל, impairmen החברתיt, גירעון תקשורת, התנהגות שחוזרת על עצמו, התנהגות כמו חרדה, ונסתרי עיכוב גירעון 8,10,12), חוסר איזון dysregulation וציטוקינים חיסוני 8,13,14, שינוי של ביטוי גנים במוח עוברי 15, אובדן של תאי פורקינג ב lobule VII של מוח קטן 11, שינוי של נכסים הסינפטי בהיפוקמפוס 9, אינטראקצית סביבת x גן 13, שינוי של חדירות מעי, ורכב חיידקים במעיים 16. יתר על כן, אסטרטגיות טיפוליות-מונעות מפותחות גם 13,16,17 מערכת מודל זה. גרימת MIA ב E12.5, ואחרים הראו כי MIA מייצרת ההפעלה microglial עוברית שינוי התפתחותי כולינרגית בקידמתו הבזליים 18, אינטראקציה ספציפית זן 19, המוח מוחין synaptosomal מומים ultrastructural, מומים hyperfunction שרשרת הנשימה במיטוכונדריה מוחין, downregulation של מולקולות synaptosomal מוחין 17 ,התנהגויות דיכאוניות דמוי, ירידת קוגניציה הגברה לטווח ארוך בהיפוקמפוס (LTP), והגירעון הנוירוגנזה בהיפוקמפוס מבוגר 20.
כאן, אנו מספקים שיטה מפורטת של איך לגרום MIA ב E12.5 ידי פולי (אני: C), כמו גם פרדיגמות של איך ליישם מודל זה ללמוד את האטיולוגיה של אוטיזם וסכיזופרניה. חשוב לציין כי MIA הוא גורם סיכון עבור מגוון רחב של הפרעות 4, ותוצאותיה רגישות במיוחד את הזמן ואת שיטת האינדוקציה וכן הבעלים של הסכרים בהריון. ככזה, אפילו סתירות קלות בין מעבדות לעתים לגרום שחזור נמוך ו / או פנוטיפים שונים אצל צאצאיהם. השיטה שלנו היא תוכננה במיוחד עבור אלו המעוניינים ללמוד MIA כגורם סיכון סביבתי לאוטיזם וסכיזופרניה, ואת התיאור המפורט הניתנים יסייע לחוקרים לשפר השחזור של הנתונים שלהם.
Protocol
Representative Results
Discussion
MIA אינדוקציה בחלונות זמן שונים מדאיגה אירועי התפתחות המוח שונים במכרסמים, וכתוצאה מכך מובילה ליקויי neuropathologies התנהגותיים שונים אצל צאצאיהם. כאן, אנו תארנו פרוטוקול לגרום MIA בעכברים עם פולי (אני: C) הזרקה ב E12.5. שיטה זו של אינדוקצית MIA מובילה התנהגותי, נוירולוגיות, אימונו?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
ברצוננו לכבד את פול ה פטרסון המנוח ד"ר על תרומתו התקדמות המודל MIA, אוטיזם, סכיזופרניה ומחקר. אנו מכירים סרקיס ק Mazmanian עבור אהדתו הגדולה על פרוטוקול זה; רובן מ באיון, איווט גרסיה-פלורס, קארן ג Lencioni, ולסלי א נוימן לסיוע מינהלי; עלי Khoshnan ויאן ג Ko על הסיוע על הצילומים; איליין י סיאו ונטליה Malkova עבור עצתם על אינדוקציה MIA; ג'פרי ס Cochrane, חואקין גוטיירז, קוואן פ לי, חיימה רודריגז, לורנה ג סנדובל, ונטלי א Verduzco לגידול צאן המומחה שלהם. עבודה זו נתמכה על ידי פרס מרכז NIH קונטה (NIH 5P50MH086383-04, לפול ח פטרסון); Autism Speaks (# 7670, לפול ח פטרסון); סימונס קרן (# 322,839, כדי סרקיס ק Mazmanian); אימון NIH גרנט (NIH / NRSA T32GM07616 כדי ק-HC); מלגת מחקר לתואר ראשון קיץ Caltech (SURF) (כדי ZY); Amgen חוקרים תוכנית בקלטק (כדי ZY); ו fr אחוות דוקטוריםאום הלאומית למדע המועצה, טייוואן (המל"ל 101-2917-I-564-039, לו'-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
Riferimenti
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H., et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I., et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L., et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L., et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. , (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31, 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2, e98 (2012).
- Hsiao, E. Y., et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K., et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J., et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3, e240 (2013).
- Khan, D., et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4, e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B., et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U., et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S., et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
