Síntesis y caracterización de un profármaco Aspirina-fumarato que inhibe la actividad de NFkB y de la mama células madre del cáncer
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
La inflamación es un sello distintivo del cáncer que subyace en la incidencia del cáncer y la promoción y progresión finalmente a la metástasis. Por lo tanto, la adición de un fármaco anti-inflamatorio a regimientos estándar contra el cáncer puede mejorar los resultados del paciente. Uno de estos fármacos, la aspirina (ácido acetilsalicílico, ASA), se ha explorado para la quimioprevención del cáncer y de la actividad anti-tumor. Además de inhibir el eje 2-prostaglandina ciclooxigenasa, actividades contra el cáncer de ASA también se han atribuido a la inhibición del factor nuclear ĸB (NFĸB). Dado que el uso prolongado puede causar ASA toxicidad gastrointestinal, una estrategia de profármaco se ha aplicado con éxito. En este profármaco diseñar el ácido carboxílico de ASA se enmascara y farmacóforos adicionales se incorporan.
Este protocolo describe cómo se sintetizó un profármaco de aspirina fumarato, GTCpFE, y caracterizado su inhibición de la vía NFĸB en células de cáncer de mama y el cáncer de atenuación de tallo-como adecuadacorbatas, un fenotipo NFĸB dependiente importante. GTCpFE inhibe eficazmente la vía NFĸB en líneas celulares de cáncer de mama, mientras que ASA carece de cualquier actividad inhibidora, indicando que la adición de fumarato a la estructura ASA contribuye significativamente a su actividad. Además, GTCpFE muestra una actividad significativa de células madre contra el cáncer mediante el bloqueo de la formación mammosphere y atenuando el CD44 asociado a las células madre del cáncer + CD24 – inmunofenotipo. Estos resultados establecen una estrategia viable para desarrollar mejores medicamentos anti-inflamatorios para la quimioprevención y tratamiento del cáncer.
Introduction
La inflamación es una característica que subyace en múltiples aspectos de la tumorigénesis, como la incidencia y la promoción y progresión finalmente a la metástasis 1. En el cáncer de mama, esto se ve apoyado por observaciones epidemiológicas que muestran que el uso regular de la aspirina fármaco no esteroide anti-inflamatorio clásica (ácido acetil salicílico, ASA) se asocia con una reducción tanto en la incidencia de cáncer de mama, y el riesgo de metástasis y recurrencia 2,3. ASA actúa principalmente mediante la inhibición de la actividad de la ciclooxigenasa-2, que a menudo se regula positivamente en el cáncer de mama 4,5. Sin embargo, los efectos anticancerígenos de ASA también puede ser mediada por la supresión del factor nuclear kappa B aberrante (NFkB) de señalización 6-8. Esto es importante porque una vía de NFkB desregulado promueve la supervivencia de células tumorales, proliferación, migración, invasión, la angiogénesis, y la resistencia a la terapia 9-11. activación de la vía NFkB también es fundamental para el montajeuna respuesta inmune. Por lo tanto, para la terapia contra el cáncer en el que se requiere la inhibición prolongada NFkB, hay que considerar los efectos secundarios perjudiciales que implican la supresión inmune de larga duración. Por lo tanto, ASA puede servir como un buen punto de partida para la optimización terapéutica.
Una limitación para la aplicación de ASA en la terapia del cáncer es las dosis elevadas requeridas para la ciclooxigenasa 2 y la inhibición de NFkB, que están asociados con toxicidad gastrointestinal, tales como úlceras y sangrado estomacal 12,13. Sin embargo, la conversión de ASA en profármaco en forma de éster, pueden reducir la toxicidad gastrointestinal de ASA. Para mejorar aún más la potencia y / o añadir funcionalidad, los elementos estructurales adicionales o farmacóforos auxiliares también se pueden incorporar en el diseño del profármaco de éster. Uno de tales farmacóforo añade para mejorar ASA potencia contra la vía de NFkB es fumarato, que hemos demostrado previamente que es importante para la inhibición de la vía NFkB 14,15.
<p class="jove_content"> Hemos sintetizado un profármaco de aspirina fumarato 15, GTCpFE, y planteó la hipótesis de que dicha molécula híbrida sería seguro todavía potente contra la vía NFkB. Hemos probado su actividad anti-NFkB en las células de cáncer de mama y su capacidad para bloquear las células madre de cáncer de mama (CSC) 15, que dependen de NFkB señalización para la supervivencia y el crecimiento de 16-21. Nos encontramos con que la potencia de GTCpFE contra la vía NFkB se mejora significativamente en AAS 15. Además, la formación de bloques GTCpFE mammosphere y atenúa el CSC marcador de superficie CD44 + CD24 – fenotipo inmune, lo que indica que GTCpFE es capaz de erradicar los CAC 15. Estos resultados establecen que el profármaco aspirina-fumarato como un agente anti-inflamatorio eficaz que también pueden dirigirse a células madre cancerosas de mama. En cuanto a la terapia del cáncer de mama, GTCpFE puede tener el potencial para tratar la enfermedad agresiva y mortal.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
Riferimenti
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
