القمع لنمو الخلايا الورم النخاعي المتعدد في فيفو بالكربون واحد-جدار أنبوب نانوي (سوكنت)--تسليم العقاقير أوليجوس MALAT1
Summary
توضح هذه المخطوطة توليف أنبوب نانوي واحد-الجدار الكربون (سوكنت)-مترافق MALAT1 جابمير العقاقير الحمض النووي اليغنوكليوتيد (سوكنت-ضد-MALAT1)، مما يدل على إيصال موثوقة سوكنت وقوية التأثير العلاجي ل مكافحة–MALAT1 في المختبر والمجراه. الأساليب المستخدمة للتوليف، والتعديل، والتصريف، وشرح لحقن سوكنت-مكافحة–MALAT1.
Abstract
أنبوب نانوي واحد-الجدار الكربون (سوكنت) هو نوع جديد من نانوحبيبات، التي كانت تستخدم لتقديم أنواع متعددة من المخدرات داخل الخلايا، مثل البروتينات والنوكليوتيد والعقاقير الاصطناعية جزيء صغير. سوكنت أبعادا قابلة للتخصيص، مساحة سطحية كبيرة، ويمكن ربط مرونة مع المخدرات من خلال تعديلات مختلفة على سطحه؛ ولذلك، نظام مثالي لنقل الأدوية إلى خلايا. الكشف فضله منذ فترة طويلة (لنكرناس) مجموعة من الجيش الملكي النيبالي فضله أطول من 200 nt, التي لا يمكن ترجمتها إلى البروتين ولكنها تلعب دوراً هاما في العمليات البيولوجية والفيزيولوجية المرضية. الرئة المرتبطة بورم خبيث غدية نسخة 1 (MALAT1) لنكرنا عالية مصانة. وثبت أن مستويات أعلى من MALAT1 المرتبطة بسوء التشخيص لأنواع السرطان المختلفة، بما في ذلك الورم النخاعي المتعدد (مم). ونحن قد كشفت عن أن ينظم MALAT1 الموت خلية وإصلاح الحمض النووي في مم؛ وهكذا، يمكن اعتبار MALAT1 كهدف علاجي ملم. ومع ذلك، الكفاءة في تقديم اليغو العقاقير لتمنع/ضربة قاضية MALAT1 الحية في ما زال مشكلة. في هذه الدراسة، نحن تعديل سوكنت مع الوتد-2000 ومترافق اليغو MALAT1 المضادة لأنه اختبار إنجاز هذا المركب في المختبر، حقن الوريد مع نموذج ماوس مم نشرها والتقيد تثبيط كبيرة لتطور مم، مما يشير إلى أن سوكنت مكوكية تسليم مثالي لمكافحة MALAT1 جابمير الحمض النووي.
Introduction
سوكنت هو نانوماتيريال رواية التي يمكنها توفير أنواع مختلفة من المخدرات، مثل البروتينات، والجزيئات الصغيرة، والأحماض النووية، ستابلي وكفاءة مع قابلية التحمل مثالية وسمية الحد الأدنى في المختبر1 و المجراة في2. سوكنت فونكتيوناليزيد كبيرة ذات قابلية الذوبان في توافق مع الحياة والمياه ويمكن استخدامها مكوك لجزيئات أصغر، ويمكن حملها على اختراق غشاء الخلية3،،من45.
لنكرناس مجموعة من الحمض النووي الريبي (> 200 nt) التي يتم نسخها من الجينوم مرناً ولكن لا يمكن ترجمتها إلى بروتينات. تزايد الأدلة أظهرت أن لنكرناس المشاركة في تنظيم التعبير الجيني6 ويشاركون في البدء والتقدم لمعظم أنواع السرطان، بما في ذلك مم7،8،9. MALAT1 نسخة فضله التخصيب النووي 2 (NEAT2) و حفظت عاليا لنكرنا10. MALAT1 معترف بها في البداية في المنتشر الخلية الصغيرة غير الرئة السرطان (NSCLC)11، ولكن قد تم overexpressed في عدة أورام5،،من1213؛ هو واحد من لنكرناس أعرب عن أشد ويرتبط مع سوء تشخيص في مم8،14. مستوى التعبير MALAT1 أعلى بكثير في دورة فادح extramedullary مم المرضى مقارنة بتلك التي شخصت فقط ملم15.
في دراسة سابقة، وقد أكدنا أن أوليجوس MALAT1 مكافحة قوة تؤدي إلى تلف الحمض النووي والمبرمج في مم16 باستخدام الحمض النووي جابمير النوكليوتيد العقاقير تستهدف MALAT1 (مكافحة-MALAT1) في الخلايا ملم. الحمض النووي جابمير تتألف من الحمض النووي العقاقير وربط 2 ‘–OMe-الكشف، الذي يمكن أن يدفع الانقسام MALAT1 ب النشاط مرة ملزمة”رناسي ح”17. لا تزال حدود كفاءة المجراة في تسليم العقاقير أوليجوس في الاستخدام السريري.
لاختبار أداء فونكتيوناليزيد أثر سوكنت لمكافحة MALAT1 جابمير أوليجوس، جابمير MALAT1 المضادة هو مترافق الحمض النووي إلى دسبي-PEG2000-أمين سوكنت. ثم يتم حقن سوكنت-ضد-MALAT1 عن طريق الوريد في نموذج نشر ماوس مم؛ ويلاحظ تثبيط ملفتة للنظر بعد أربعة علاجات.
Protocol
Representative Results
Discussion
وتبين الأدلة أن لنكرناس المشاركة في تنظيم العديد من إجراءات الفسيولوجية والفيزيولوجية المرضية في حالات السرطان، بما في ذلك مم7،،من89؛ لديهم القدرة على أن تكون هدفا لعلاج السرطان، التي يمكن أن تتحقق بالعقاقير النوكليوتيد20<sup…
Disclosures
The authors have nothing to disclose.
Acknowledgements
يشكر المؤلفون بمعهد أبحاث ليرنر البروتين، الجينوم، وأساسيات التصوير لما قدمته من المساعدة ودعم. التمويل: كان يؤيد هذا العمل ماليا بالمعاهد الوطنية للصحة/NCI منحة R00 CA172292 (J.J.Z.) وأموال بدء التشغيل (ل J.J.Z.) والسريرية ومتعدية العلوم التعاونية (كتس) قضية Western Reserve جامعة الأساسية استخدام الطيار غرانت (إلى J.J.Z.). هذا العمل استخدام المجهر SP8 إيكا [كنفوكل] التي تم شراؤها بتمويل من “المعاهد الوطنية للصحة سيج” المنح 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
