Multipl Miyelom hücre büyümesini Vivo tek-duvar karbon nanotüp (SWCNT) tarafından yapılan bir baskı-MALAT1 antianlamlı Oligos teslim
Summary
Bu el yazması bir tek-duvar karbon nanotüp (SWCNT) sentezi açıklar-SWCNT güvenilir teslim ve güçlü tedavi edici etkisini gösteren MALAT1 antianlamlı gapmer DNA oligonükleotid (SWCNT-anti-MALAT1), Birleşik Anti-MALAT1 tüp bebek ve içinde vivo. Yöntemleri kullanılan sentez, değiştirme, fiil ve SWCNT-anti-MALAT1 enjeksiyon açıklanmıştır.
Abstract
Tek-duvar karbon nanotüp (SWCNT) olan hücrelere, proteinler, oligonucleotides ve sentetik küçük molekül uyuşturucu gibi birden fazla çeşit uyuşturucu dağıtmak için kullanılan nanopartikül, yeni bir türüdür. SWCNT özelleştirilebilir boyutları, yüzeysel geniş bir alanı vardır ve esnek yüzeyinde farklı değişiklikler yoluyla uyuşturucu ile bağlayabilirsiniz; Bu nedenle, uyuşturucu hücreye taşımak için ideal bir sistemdir. Uzun kodlamayan RNA’ların (lncRNAs) bir küme kodlamayan RNA 200 daha uzun olan nt, protein çevrilemeyen ancak biyolojik ve patofizyolojik işlemlerinde önemli bir rol oynamaktadır. Metastaz ilişkili akciğer adenokarsinom transkript 1 (MALAT1) son derece korunmuş bir lncRNA olduğunu. Yüksek MALAT1 düzeyleri multipl miyelom (MM) de dahil olmak üzere çeşitli kanserlerin kötü prognoz ile ilgili gösterilmiştir. Biz-si olmak kâşif MALAT1 DNA tamiri ve hücre ölüm mm düzenler; Böylece, MALAT1 MM için terapötik hedef olarak kabul edilebilir. Ancak, antianlamlı oligo verimli bir şekilde teslim inhibe/nakavt vivo içinde MALAT1 için hala bir sorundur. Bu çalışmada biz PEG-2000 ile SWCNT değiştirmek ve bunu bir anti-MALAT1 oligo eşlenik, bu bileşik tüp bebek teslim test etmek, Dissemine bir MM fare modeli olarak intravenöz enjekte etmek ve MM progresyon gösteren önemli bir inhibisyon gözlemlemek o SWCNT bir ideal teslimat servisi için anti-MALAT1 gapmer DNA’sı var.
Introduction
SWCNT çeşitli ilaçlar, nükleik asitler, proteinler ve küçük moleküller gibi ideal tolerabilite ve in vitro1 ve içinde vivo2en az toksisite stably ve verimli bir şekilde sunabilir bir roman nanomaterial var. Functionalized SWCNT büyük biyouyumluluk ve su çözünürlük vardır, bir mekik daha küçük moleküller için kullanılabilir ve hücre zarının3,4,5nüfuz onları taşıyabilir.
lncRNAs olan bir küme RNA’ın (> 200 nt) bu mRNA için genom transkripsiyonu ama protein çevrilemez. Kanıt artan lncRNAs gen ifade6 Yönetmelikte katılmak ve inisiyasyon ve en tip-in MM7,8,9dahil olmak üzere kanser progresyon katılmaktadırlar göstermiştir. MALAT1 olan bir nükleer zenginleştirilmiş kodlamayan transkript 2 (NEAT2) ve son derece korunmuş lncRNA10. MALAT1 başlangıçta metastatik olmayan küçük hücreli akciğer kanseri (NSCLC)11‘ kabul edilmektedir, ancak çok sayıda tümör5,12,13‘ te overexpressed; en çok ifade lncRNAs biridir ve kötü prognoz MM8,14ile ilişkilidir. MALAT1 ifade düzeyini yalnızca MM15tanısı göre ölümcül ders ekstramedullar MM hastalarda anlamlı olarak daha yüksek.
Bir önceki çalışmada, biz anti-MALAT1 oligos sağlam DNA hasarı ve MM16 apoptosis gapmer DNA antianlamlı oligonucleotides MALAT1 hedefleme kullanarak yol doğruladı (anti-MALAT1) MM hücrelerdeki. Gapmer DNA antianlamlı DNA’sı oluşur ve 2′-OMe-hangi MALAT1 bölünme RNase H bir kez bağlı etkinlik17tarafından sor RNA’ların, bağlanmıştır. Antianlamlı oligos içinde vivo teslim verimliliğini hala klinik kullanımını sınırlar.
Teslim test etmek için SWCNT etkisi için anti-MALAT1 gapmer oligos, DNA DSPE-PEG2000-Amin için Birleşik anti-MALAT1 gapmer SWCNT functionalized. SWCNT-anti-MALAT1 sonra intravenöz bir MM Dissemine fare modeli enjekte edilir; çarpıcı bir inhibisyon dört tedaviler sonra görülmektedir.
Protocol
Representative Results
Discussion
Kanıt lncRNAs kanserler, MM7,8,9dahil olmak üzere çok sayıda fizyolojik ve patofizyolojik yordamlarda yönetmelikte yer almak göstermiştir; Onlar antianlamlı oligonucleotides20,21,22tarafından gerçekleştirilebilir kanser tedavisi için hedef olma potansiyeline sahip. ABD Gıda ve İlaç Dairesi (FDA) fomivirsen sitomegalovirü…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Yazarlar Lerner Araştırma Enstitüsü proteomik, genomik ve görüntüleme göbek onların yardım için teşekkür ederiz ve destek. Fonlama: Bu eser mali NIH/ncı hibe R00 CA172292 (J.J.Z.) ve başlangıç fonlar (için J.J.Z.) ve klinik ve çevirim bilim işbirlikçi (CTSC) Case Western Reserve Üniversitesi temel kullanımı Pilot hibe (için J.J.Z.) tarafından desteklenmiştir. Bu eser Ulusal Sağlık Enstitüleri SIG grant 1S10OD019972-01 ile fon ile satın alınmış Leica SP8 confocal mikroskop kullanılmaktadır.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
