Sistema de cultivo tridimensional sin suero para células madre de la glándula lagrimal
Summary
El método tridimensional de cultivo sin suero para células madre adultas de la glándula lagrimal (LG) está bien establecido para la inducción de la formación y diferenciación de organoides LG en células acinares o similares a las ductales.
Abstract
La terapia basada en células madre de la glándula lagrimal (LG) es una estrategia prometedora para las enfermedades de la glándula lagrimal. Sin embargo, la falta de un método de cultivo confiable y libre de suero para obtener un número suficiente de células madre LG (LGSC) es un obstáculo para futuras investigaciones y aplicaciones. El método de cultivo tridimensional (3D), libre de suero para LGSC de ratones adultos está bien establecido y se muestra aquí. Las LGSC podrían ser continuamente pasajeras e inducidas a diferenciarse a células acinares o similares a las ductales.
Para el cultivo primario lgsc, los LGs de ratones de 6-8 semanas de edad fueron digeridos con dispasa, colagenasa I y tripsina-EDTA. Un total de 1 × 104 células individuales fueron sembradas en 80 μL de matriz de células madre de células madre de gel-glándula lagrimal (LGSCM) en cada pocillo de una placa de 24 pocillos, precubierta con 20 μL de matriz gel-LGSCM. La mezcla se solidificó después de la incubación durante 20 min a 37 °C, y se agregaron 600 μL de LGSCM.
Para el mantenimiento de LGSC, los LGSC cultivados durante 7 días se desagregaron en células individuales por dispasa y tripsina-EDTA. Las células individuales fueron implantadas y cultivadas de acuerdo con el método utilizado en el cultivo primario LGSC. Las LGSC podrían pasar más de 40 veces y expresar continuamente los marcadores de células madre/progenitoras Krt14, Krt5, P63 y nestina. Las LGSC cultivadas en LGSCM tienen capacidad de autorrenovación y pueden diferenciarse en células acinares o ductales in vitro e in vivo.
Introduction
Las células madre de la glándula lagrimal (LGSC) mantienen la renovación celular de la glándula lagrimal (LG) y son la fuente de células acinares y ductales. Por lo tanto, el trasplante lgsc se considera un enfoque alternativo para tratar el daño inflamatorio severo y la enfermedad del ojo seco con deficiencia acuosa (AÑAD)1,2,3. Se han aplicado varios métodos de cultivo para enriquecer LGSCs. Tiwari et al. separaron y cultivaron células primarias de LG utilizando colágeno I y gel de matriz complementado con varios factores de crecimiento; sin embargo, las células LG no pudieron ser cultivadas continuamente4. Utilizando cultivo bidimensional (2D), las células madre derivadas de LG de ratón fueron aisladas por You et al.5 y Ackermann et al. 6, se encontró que expresa los genes marcadores de células madre / progenitoras, Oct4, Sox2, Nanog y nestina, y podría ser subcultivado. Sin embargo, no hay indicios claros de que estas células puedan diferenciarse en células acinares o ductales, y no existe un experimento de trasplante para verificar el potencial de diferenciación in vivo.
Recientemente, las células c-kit+ dim/EpCAM+/Sca1–/CD34–/CD45– se aislaron de LIG de ratón mediante citometría de flujo, se encontró que expresaban marcadores de células progenitoras LG, como Pax6 y Runx1, y se diferenciaron en conductos y acini in vitro. En ratones con ADD, la inyección ortotópica con estas células podría reparar las GL dañadas y restaurar la función secretora de lasGL 2. Sin embargo, el número de células madre aisladas por este método fue pequeño, y no hay condiciones de cultivo adecuadas para expandir las LGSC aisladas. En resumen, es necesario establecer un sistema de cultivo adecuado para aislar y cultivar eficazmente las LGSC adultas con expansión estable y continua para el estudio de las LGSC en el tratamiento de la ADICIÓN.
Los organoides derivados de células madre o células madre pluripotentes son un grupo de células que son histológicamente similares a los órganos relacionados y pueden mantener su propia renovación. Después de que el organoide del intestino de ratón fue cultivado con éxito por Sato et al. en 20097, se cultivaron organoides de otros órganos en sucesión, según el sistema de cultivo de Sato, como la vesícula biliar8, el hígado9, el páncreas10, el estómago11, la mama12, el pulmón13, la próstata14 y la glándula salival15 . Debido a la alta proporción de células madre adultas antes de la diferenciación celular en cultivo organoide, el método de cultivo organoide tridimensional (3D) se considera óptimo para el aislamiento y cultivo de células madre adultas de LG.
En el presente estudio se estableció un sistema de cultivo LGSC de ratón adulto mediante la optimización del método de cultivo 3D, libre de suero. Está comprobado que las LGSC cultivadas tanto en ratones normales como en ratones ADDED mostraron una capacidad estable de autorrenovación y proliferación. Después del trasplante en los GL de ratón ADDED, los LGSC colonizaron los LGs deteriorados y mejoraron la producción de lágrimas. Además, se aislaron LGSC fluorescentes rojos de ratones ROSA26mT/mG y se cultivaron. Este trabajo proporciona una referencia confiable para el enriquecimiento LGSC in vitro y el autoinjerto LGSC en aplicación clínica para la terapia CON ADD.
Protocol
Representative Results
Discussion
Existen métodos bien establecidos para el aislamiento y el cultivo in vitro de células madre lagrimales para el cultivo de células madre lagrimales y la reparación de lesiones LG. Shatos et al.17 y Ackermannet al. 6 células madre lagrimales cultivadas y subcultivadas con éxito de ratas y ratones mediante métodos de cultivo 2D, respectivamente, lo que permite trasplantar células madre lagrimales para el tratamiento del TDA. Los estudios sobre célul…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Este trabajo fue apoyado por una subvención de la Fundación Nacional de Ciencias Naturales de China (No. 31871413) y dos Programas de Ciencia y Tecnología de Guangdong (2017B020230002 y 2016B030231001). Estamos realmente agradecidos a los investigadores que nos han ayudado durante el estudio y a los miembros del personal que trabajan en el centro de animales por su apoyo en el cuidado de los animales.
Materials
| Animal(Mouse) | |||
| Bal B/C | Model Animal Research Center of Nanjing University | ||
| C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
| NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
| ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
| Equipment | |||
| Analytical balance | Sartorius | ||
| Automatic dehydrator | Thermo | ||
| Blood counting chamber | BLAU | ||
| Cell Counter | CountStar | ||
| CO2 constant temperature incubator | Thermo | ||
| ECL Gel imaging system | GE healthcare | ||
| Electric bath for water bath | Yiheng Technology | ||
| Electrophoresis apparatus | BioRad | ||
| Fluorescence quantitative PCR instrument | Roche | ||
| Frozen tissue slicer | Lecia | ||
| Horizontal centrifuge | CENCE | ||
| Inverted fluorescence microscope | Nikon | ||
| Inverted microscope | Olympus | ||
| Laser lamellar scanning micrograph | Carl Zeiss | ||
| Liquid nitrogen container | Thermo | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| Micropipettor | Gilson | ||
| Microwave oven | Panasonic | ||
| Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
| Paraffin slicing machine | Thermo | ||
| PCR Amplifier | Eppendorf | ||
| pH value tester | Sartorius | ||
| 4 °C Refrigerator | Haier | ||
| Thermostatic culture oscillator | ZHICHENG | ||
| Tissue paraffin embedding instrument | Thermo | ||
| -80°C Ultra-low temperature refrigerator | Thermo | ||
| -20°C Ultra-low temperature refrigerator | Thermo | ||
| Ultra pure water purification system | ELGA | ||
| Reagent | |||
| Animal Experiment | |||
| HCG | Sigma | 9002-61-3 | |
| PMSG | Sigma | 14158-65-7 | |
| Pentobarbital Sodium | Sigma | 57-33-0 | |
| Cell Culture | |||
| B27 | Gibco | 17504044 | |
| Collagenase I | Gibco | 17018029 | |
| Dispase | BD | 354235 | |
| DMEM | Sigma | D6429 | |
| DMEM/F12 | Sigma | D0697 | |
| DMSO | Sigma | 67-68-5 | |
| EDTA | Sangon Biotech | A500895 | |
| Foetal Bovine Serum | Gibco | 04-001-1ACS | |
| GlutaMax | Gibco | 35050087 | |
| Human FGF10 | PeproTech | 100-26 | |
| Matrigel (Matrix gel) | BD | 356231 | |
| Murine Noggin | PeproTech | 250-38 | |
| Murine Wnt3A | PeproTech | 315-20 | |
| Murine EGF | PeproTech | 315-09 | |
| NEAA | Gibco | 11140050 | |
| N2 | Gibco | 17502048 | |
| R-spondin 1 | PeproTech | 120-38 | |
| Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
| Trypsin | Sigma | T4799 | |
| Y-27632 | Selleck | S1049 | |
| HE staining & Immunostaining | |||
| Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
| Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
| Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
| Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
| Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
| Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
| Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
| C6H8O7 | Sangon Biotech | A501702-0500 | |
| Citric Acid | Sangon Biotech | 201-069-1 | |
| DAB Kit (20x) | CWBIO | CW0125 | |
| DAPI | Thermo | 62248 | |
| Eosin | BASO | 68115 | |
| Fluorescent Mounting Medium | Dako | S3023 | |
| Formalin | Sangon Biotech | A501912-0500 | |
| Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
| Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
| Hematoxylin | BASO | 517-28-2 | |
| Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
| 30% H2O2 | Guangzhou Chemistry | KD10 | |
| 30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
| Methanol | Guangzhou Chemistry | 67-56-1 | |
| Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
| Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
| Non-immunized Goat Serum | BOSTER | AR0009 | |
| Paraffin | Sangon Biotech | A601891-0500 | |
| Paraformaldehyde | DAMAO | 200-001-8 | |
| Saccharose | Guangzhou Chemistry | 57-50-1 | |
| Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
| Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
| Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
| Triton X-100 | DINGGUO | 9002-93-1 | |
| Xylene | Guangzhou Chemistry | 128686-03-3 | |
| RT-PCR & qRT-PCR | |||
| Agarose | Sigma | 9012-36-6 | |
| Alcohol | Guangzhou Chemistry | 64-17-5 | |
| Chloroform | Guangzhou Chemistry | 865-49-6 | |
| Ethidium Bromide | Sangon Biotech | 214-984-6 | |
| Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
| LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
| ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
| Taq DNA Polymerase | TAKARA | R10T1 | |
| Goldview (nucleic acid stain) | BioSharp | BS357A | |
| TRIzol | Magen | R4801-02 | |
| Vector Construction & Cell Transfection | |||
| Agar | OXID | – | |
| Ampicillin | Sigma | 69-52-3 | |
| Chloramphenicol | Sigma | 56-75-7 | |
| Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
| Kanamycin | Sigma | 25389-94-0 | |
| Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
| LR Reaction Kit | Thermo | 11791019 | |
| Plasmid Extraction Kit | TIANGEN | DP103 | |
| Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
| Trytone | OXID | – | |
| Yeast Extract | OXID | – | |
| Primers and Sequence | Company | ||
| Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
| Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
| Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
| Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
| Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
| Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
| Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
| Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
| Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
| Vector | |||
| pLX302 lentivirus no-load vector | Addgene | ||
| pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |
Riferimenti
- Zoukhri, D., Macari, E., Kublin, C. L. A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Experimental Eye Research. 84 (5), 894-904 (2007).
- Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Translational Medicine. 6 (1), 88-98 (2016).
- Buzhor, E., et al. Cell-based therapy approaches: the hope for incurable diseases. Regenerative Medicine. 9 (5), 649-672 (2014).
- Tiwari, S., et al. Establishing human lacrimal gland cultures with secretory function. PLoS One. 7 (1), 29458 (2012).
- You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. Isolation and propagation of mesenchymal stem cells from the lacrimal gland. Investigative Ophthalmology & Visual Science. 52 (5), 2087-2094 (2011).
- Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Investigative Ophthalmology & Visual Science. 56 (8), 4350-4363 (2015).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
- Lugli, N., et al. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Reports. 17 (5), 769-779 (2016).
- Huch, M., et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell. 160 (1), 299-312 (2015).
- Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1), 324-338 (2015).
- Barker, N., et al. Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 6 (1), 25-36 (2010).
- Linnemann, J. R., et al. Quantification of regenerative potential in primary human mammary epithelial cells. Development. 142 (18), 3239-3251 (2015).
- Rock, J. R., et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).
- Chua, C. W., et al. Single luminal epithelial progenitors can generate prostate organoids in culture. Nature Cell Biology. 16 (1), 951-961 (2014).
- Maimets, M., et al. Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals. Stem Cell Reports. 6 (1), 150-162 (2016).
- Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Research & Therapy. 11 (1), 20 (2020).
- Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland. Investigative Ophthalmology & Visual Science. 53 (6), 2749-2759 (2012).
- Mishima, K., et al. Transplantation of side population cells restores the function of damaged exocrine glands through clusterin. Stem Cells. 30 (9), 1925-1937 (2012).
- Aluri, H. S., et al. Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sjögren’s syndrome. Stem Cells International. 2017, 1-10 (2017).
- Dietrich, J., Schrader, S. Towards lacrimal gland regeneration: current concepts and experimental approaches. Current Eye Research. 45 (3), 230-240 (2020).
- Sato, T., Clevers, H. SnapShot: growing organoids from stem cells. Cell. 161 (7), 1700 (2015).
- Kleinman, H. K., Martin, G. R. Matrigel: basement membrane matrix with biological activity. Seminars in Cancer Biology. 15 (5), 378-386 (2005).
- Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. Basement membrane matrix (BME) has multiple uses with stem cells. Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).
