High-Resolution Melting PCR to Determine Sequence Variations in Mutant DNA Sequences

Published: May 31, 2023

Abstract

Source: Kisserli, A., et al. High-resolution Melting PCR for Complement Receptor 1 Length Polymorphism Genotyping: An Innovative Tool for Alzheimer's Disease Gene Susceptibility Assessment. J. Vis. Exp. (2017).

In this video, we describe a high-resolution melting PCR technique to determine the length polymorphism of DNA fragments of varying sequence lengths, based on melting temperature analysis.

Protocol

1. HRM-PCR Protocol Thaw the DNA samples. Dilute the DNA samples in 1.5 mL tubes with water to adjust them to a concentration of 10 ng/µL NOTE: The total volume of diluted DNA should be between 2 µL and 10 µL. Thaw the primer solutions. Dilute the primer solutions in 1.5-mL tubes with water to adjust them to the same concentration of 6 µM. NOTE: The primer sequences and reaction conditions are provided in Table 1.</…

Representative Results

Figure 1: Screenshots of the graphical interface of the software used in step 2 of the protocol. (A) Open the gene scanning software. (B) Amplification program and melting curve program. (C) Click on Sample editor in the Module bar. (D) Select Scanning. (E) Define the properties of the samples. …

Disclosures

The authors have nothing to disclose.

Materials

Lab coat protection
SensiCareIce powder-free Nitrile Exam gloves Medline Industries, Inc, Mundelein, IL 60060, USA 486802 sample protection
Eppendorf Reference 2 pipette, 0.5-10µL Eppendorf France SAS, F-78360 Montesson, France 4920000024 sample pipetting
Eppendorf Reference 2 pipette, 20-100µL Eppendorf France SAS, F-78360 Montesson, France 4920000059 sample pipetting
Eppendorf Reference 2 pipette, 100-1000µL Eppendorf France SAS, F-78360 Montesson, France 4920000083 sample pipetting
TipOne 10µL Graduated, filter tip Starlab GmbH, D-22926 Ahrenburg, Germany S1121-3810 sample pipetting
TipOne 1-100µL bevelled, filter tip  Starlab GmbH, D-22926 Ahrenburg, Germany S1120-1840 sample pipetting
ART 1000E Barrier Tip Thermo Fischer Scientific , F-67403 Illkirch, France 2079E sample pipetting
Eppendorf Safe-Lock Tubes, 1.5 mL, Eppendorf Quality Eppendorf France SAS, F-78360 Montesson, France 30120086 mix
Vortex-Genie 2 Scientific Industries, Inc, Bohemia, NY 111716, USA SI-0236 mix
Mikro 200 centrifuge Hettich Zentrifugen, D-78532, Germany 0002020-02-00 centrifugation
Multipette E3 Eppendorf France SAS, F-78360 Montesson, France 4987000010 distribution
Light Cycler 480 multiwell plate 96, white Roche Diagnostics GmbH, D-68305 Mannheim, Germany 4729692001 reaction place
Light Cycler 480 sealing foil Roche Diagnostics GmbH, D-68305 Mannheim, Germany 4429757001 coverage
LightCycler 480 Instrument II, 96-well Roche Diagnostics GmbH, D-68305 Mannheim, Germany 05015278001 high resolution melting polymerase chain reaction
Heraeus Megafuge 11R centrifuge Thermo Fischer Scientific , F-67403 Illkirch, France 75004412 centrifugation
LightCycler 480 High Resolution Melting Master Roche Diagnostics GmbH, D-68305 Mannheim, Germany 04909631001 reaction reagents
CN3 primer: 5'ggccttagacttctcctgc 3' Eurogentec Biologics Division, B4102 Seraing, Belgium reaction reagent
CN3re primer: 5'gttgacaaattggcggcttcg 3' Eurogentec Biologics Division, B4102 Seraing, Belgium reaction reagents
light cycler 480 SW 1.5.1 software Roche Diagnostics GmbH, D-68305 Mannheim, Germany software used for HRM-PCR CR1 polymorphism data analysis

Tags

Play Video

Cite This Article
High-Resolution Melting PCR to Determine Sequence Variations in Mutant DNA Sequences. J. Vis. Exp. (Pending Publication), e21360, doi: (2023).

View Video