Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.
약물 대사 및 염증의 중요한 조절 제로, Pregnane X 수용체 (PXR)는, 대사 및 염증 (예, 간 지방증) 1,2 연결 질병 병태 생리에서 중요한 역할을한다. PXR에 대한 효능 리간드의 식별에 많은 진전이 있었다, 그러나, 마약과 같은 길항제 및 PXR 3,4,5 그들의 결합 부위의 제한에 대한 설명이 있습니다. 중요한 장벽을 효율적으로 PXR는 1998 년에 복제 및 특징되었다는 사실에도 불구하고 길항제와 구조 연구에 대한 전체 길이의 단백질을 정화하는 무능력이다. 우리 연구소는 PXR 6 잔류 물을 결합, 길항제, 케토코나졸의를 정의하는 기반으로 소설 높은 처리량 효모 두 하이브리드 분석을 개발했다. 우리의 방법은 케토코나졸과 상호 작용 할 것으로 예상 PXR의 AF-2면에 하나의 돌연변이의 효과를 구출 할 돌연변이 라이브러리를 만드는 작업이 포함됩니다. 구조 또는 "기능 획득"세코ND 돌연변이 PXR에 케토코나졸의 유전 적 상호 작용과 표면 잔기 (들)에 관한 결론이 실현 가능하도록 만들어 질 수있다. 따라서, 우리는 그것의 보조 활성화, SRC-1과 상호 작용 PXR 돌연변이의 높은 처리량을 두 하이브리드 효모 화면을 개발했다. 효모는 항진균제, 케토코나졸의 연구를 수용하기 위해 수정 된이 방식을 사용하여, 우리는 케토코나졸에 바인딩 할 수 없습니다 클론 풍부한 PXR의 특정 변이를 설명 할 수 있습니다. 반대 논리에 의해, 우리는 원래의 잔류 케토코나졸과의 직접적인 상호 작용 잔류 있다는 결론을 내린다. 이 분석은 소설, 핵 수용체 길항제 표면에 결합 부위에 대한 화면으로 다루기 쉬운 유전자 분석을 나타냅니다. 이 분석은 효모뿐만 아니라 표준 구조 생물학 또는 단백체 기반 방법을 사용하여 연구 할 수없는 세포 단백질 (들)에 관계없이 세포 독성 가능성의 약물에 적용 할 수 있습니다. 잠재적 인 함정은 데이터의 해석 (보완적인 방법으로 유용), 신뢰성을 포함단일 Y2H 방법, 효모 처리 또는 효모 두 하이브리드 분석을 수행하는 전문 지식 및 분석 최적화에 ANCE.
The yeast two-hybrid (Y2H) assay is widely used to discover protein-protein interactions and more recently for discovery of novel small molecules that disrupt protein-protein interaction complexes 7, 8, 9, 10, 11. However, the conventional approaches of this assay, used for drug discovery or "hits", do not allow for detection of allosteric interaction residues of chemicals compounds within protein-protein surfaces, that when altered still interact and allow for interrogation of the altered residues11. Indeed, such a method(s), if feasible to develop, would enable a tractable yeast system for high throughput assessment of allosteric interaction residues critical for protein-protein interaction disruption. In the context of drug discovery, the most direct way to establish interaction of compounds with proteins would involve structural determination (e.g. crystalization of protein-inhibitor complex). These methods are cumbersome, use elaborate resources and it is not technically feasible to perform structural studies on every protein.
Tractable genetic drug screening systems have been established in bacteria1, 2 and other model systems like mammalian two-hybrid. However, these systems need optimization and alternative systems like Y2H are still the most tested in drug discovery. There are limitations that include poor sensitivity and reliability of interactions using singular methods13 , however, a single Y2H assay can be modified to answer specific questions regarding interaction residues. In the field of nuclear receptor research, Y2H has been used to define interacting proteins14, however, these protein interactions have rarely been used to define the nature in which ligands/antagonists interact with nuclear receptor-protein complexes. Thus, our laboratory focused efforts on defining a method, especially for receptor proteins that are not readily amenable to proteomic based methods, that would unearth novel ligand/antagonist interacting residues using a reverse Y2H based discovery platform.
Based on our previous finding that ketoconazole disrupts PXR and its activator SRC-1, we developed a novel reverse Y2H system that enable us to define and interrogate ketoconazole interacting residues on PXR6. Our method is based on the properties of the yeast GAL4 protein that consists of separable domains responsible for DNA-binding and transcriptional activation. The PXR LBD protein is expressed as a fusion to the LexA DNA-binding domain (DNA-BD), while the full length co-activators SRC-1 (steroid receptor coactivator 1) proteins are expressed as fusions to the GAL4 activation domain (AD). Interaction between PXR and SRC-1 fusion proteins leads to the transcriptional activation of GAL4-binding sites containing reporter gene β-LacZ that is integrated into the yeast genome. Ketoconazole, a PXR antagonist, disrupts PXR and SRC-1 interaction 15, 16, 17 and we can detect the interaction of PXR and SRC-1 in the presence or absence of ketoconazole after staining colonies on filters for X-gal activity. The principle of Y2H is illustrated in Figure 1 and the experimental procedure is summarized in Figure 2.
In our modified Y2H assay, we have identified important residues for ketoconazole interactions on PXR6. Since SRC-1 is a coactivator (and was cloned into the pGADNot vector), we also tested whether SRC-1 could activate lacZ expression when cloned into the pSH vector system and whether this would change the activation profile and/or affect the leakiness of the yeast two-hybrid assay. Using our redesigned plasmids we performed two-hybrid assays in erg3Δ/erg11Δ yeast. As before, we sho…
The authors have nothing to disclose.
This work was supported by National Institutes of Health (NIH) Grants CA127231 and The Damon Runyon Foundation Clinical Investigator Award (CI 1502) (to S.M). We would like to thank Professor Zdenek Dvorak from Palacky University Olomouc, Czech Republic for his helpful insights into discussing portability of this technique to their institution and standardization of protocol.
Name | Company | Catalog Number | Comments |
Yeast Strain CTY10-5d erg3Δ/erg11Δ | Our lab | CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 . | |
YPD Growth Medium | BD Biosciences | 630409 | |
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate | BD Biosciences | 233520 | |
Bacto Agar | BD Biosciences | 214010 | |
CSM-His/-Leu Complete Supplement Mixture | MP Biomedicals | 4250-412 | |
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). | Sigma-Aldrich | N1127 | |
2-Mercaptoethanol | Sigma-Aldrich | M6250 | |
Luria Broth (LB) | Sigma-Aldrich | L3022 | |
X-Gal | Fisher | BP-1615 | |
Sonicated Salmon Sperm DNA boiled (10 mg/ml) | Life Technology | 156-017 | |
Ampicillin | Acros Organics | 61177 | |
Ketoconazole | Sigma-Aldrich | K1003 | |
N,N-Dimethylformamide | Acros Organics | 326871000 | |
Lithium Acetate | Sigma-Aldrich | L4158 | |
50% PEG-3350 solution, filter-sterilized | Sigma-Aldrich | P-3640 | |
Nitrocellulose Membrane | Whatman | 10402091 | |
10 cm Petri Dish | Fisher | 875712 | |
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' | our lab | PXR LBD forward primer for pSH2-1 | |
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' | our lab | PXR LBD reverse primer for pSH2-1 | |
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' | our lab | SRC-1 forward primer for pGADNOT | |
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' | our lab | SRC-1 reverse primer for pGADNOT | |
Platinum PCR Supermix | Invitrogen | 11306-016 | |
BamHI | our lab | R0136 | |
SalI | our lab | R0138 | |
NotI | our lab | R0189 |