Frågan om hur kromatin tillsynsmyndigheter och kromatin stater påverkar genomet in vivo är nyckeln till vår förståelse av hur tidigt cell öde beslut fattas i det växande embryot. Chip-Seq-mest populära tillvägagångssätt för att undersöka kromatin funktioner på global nivå-skisseras här för Xenopus embryon.
The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.
The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes.
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species—X. tropicalis and X. laevis—have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.
Vår protokoll beskriver hur man gör och analysera genomet hela kromatin profiler från Xenopus embryon. Den täcker varje steg från tvärbindande proteiner till endogena loci in vivo till bearbetning miljontals läser representerar anrikade iska platser i silico. Eftersom allt fler genom utkast finns tillgängliga bör detta protokoll tillämpas på andra modell och icke-modellorganismer. Den viktigaste experimentella avsnitt, som anger detta protokoll bortsett från tidigare arbeten 8,31,33,34, är den efter fixering procedur att extrahera tvärbundna kärnor. Det underlättar effektiv kromatin solubilisering och kapning och enkel uppskalning. Tillsammans med förbättrade effektiviteten av biblioteks förberedelser detta protokoll möjliggör byggandet av hög komplexitet spån Seq bibliotek från halv till två miljoner celler som uttrycker kromatin-associerade epitopen av intresse. För Chip-qPCR experiment, några tio tusen av dessa celler är normalt tillräckligtatt kontrollera om DNA anrikning vid kanske sex distinkta iska loci. Dessa siffror är konservativa uppskattningar, men kan variera beroende på proteinuttryck nivå, antikropps kvalitet, tvärbindningseffektivitet och epitop tillgänglighet. Som en guide, innehåller en enda Xenopus embryo ca 4000 celler vid mitten blastula skede (8,5 efter Nieuwkoop och Faber 29), 40.000 celler vid sena gastrulastadium (12) och 100.000 celler vid tidiga tailbud stadiet (20).
Den exakta fixering tiden för effektiv immunoutfällning måste fastställas empiriskt av Chip-qPCR (avsnitt 10). I allmänhet är längre fixeringstider krävs om försöket involverar X. laevis embryon, tidiga utvecklingsstadier, och svaga (eller indirekta) DNA bindningsegenskaper. Det är dock inte att rekommendera om fastställande Xenopus embryon längre än 40 minuter, eller bearbeta fler embryon än vad som anges (avsnitt 3), kromatin klippning blir mindre effektiv. Det är viktigt att inteatt använda glycin efter fixering som denna gemensamma steg för härdning formaldehyd kan göra kärn extraktion från gulerika embryon mycket svåra. För närvarande är orsaken till detta inte är känd. Det är tänkbart att formaldehyd-glycin addukt reagerar vidare med N-terminal amino-grupper eller argininresterna 35.
Antikroppen är nyckeln till alla chip experiment och tillräckliga kontroller måste genomföras för att visa sin specificitet för epitop av intresse (se riktlinjer genom et al. Landt 36). Om ingen Chip-grade antikropp är tillgänglig, kan införandet av motsvarande epitopmärkta fusionsproteiner vara ett legitimt alternativ eftersom dessa proteiner kan ockupera endogena bindningsställen 37. I det här fallet, oinjicerade embryon är bäst att använda som en negativ kontroll snarare än en chip med ospecifik serum. Denna strategi kan även appliceras om proteinet av intresse uttrycks vid låga nivåer resulterar i dålig utvinning av EnriCHED DNA.
När det gäller att göra ChIP-Seq bibliotek, på grund av den låga mängden DNA i bruk, är det rekommenderat att välja förfaranden som minskar antalet rengöringssteg och att kombinera reaktioner för att hålla någon förlust av DNA vid ett minimum. De adaptrar och primers måste vara kompatibla med multiplex sekvense och NGS plattformen (se tabell på specifika material / utrustning). Vid användning av Y-adaptrar (innehållande långa enkelsträngade armar), är det kritiskt att pre-amplifiera biblioteket med 3-5 omgångar av PCR före storleksvälj DNA-inlägg (t.ex.., 100 till 300 bp) genom gelelektrofores. Enkelsträngade ändarna orsaka DNA-fragment att migrera heterogent. Provkörningar med olika mängder av ingångs DNA (t.ex., 0,1, 0,5, 1, 2, 5, 10 och 20 ng) rekommenderas för att fastställa det totala antalet PCR-cykler (mindre än eller lika med 18 cykler) som krävs för att göra en storlek -utvalda bibliotek med 100 till 200 ng. Att minska antalet PCR-cykler gör sekvenseringen av redundant läser mindre troligt. Fast fas reversibla immobilisering pärlor är bra att städa upp reagenser för att effektivt återvinna DNA av intresse och tillförlitligt avlägsna eventuella fria adaptrar och dimerer från ligering och PCR-reaktioner.
Sett till antal, typ och längd läser, cirka 20 till 30.000.000 enda änden läser av 36 bp är tillräckligt för de flesta spån Seq experiment för att täcka hela Xenopus genomet med tillräckligt djup. De vanligaste NGS maskiner rutinmässigt kan uppfylla dessa kriterier. Det kan dock vara fördelaktigt att öka antalet läser om en bred fördelningar av läser förväntas, som kan ses med histon modifikationer, snarare än skarpa toppar. För många spån Seq experiment, kan 4-5 olika indexe bibliotek slås samman och sekvens i en flödescell körfält med hjälp av en högpresterande NGS maskin. Ibland är också lämpligt att förlänga den lästa längd och sekvens båda ändarna av DNA-mallen (parade slut) för att öka mappability whöna analysera kromatin inom repetitiva iska regioner.
Detta protokoll har tillämpats med framgång på en bred variation av kromatin funktioner såsom transkriptionsfaktorer, signal medlare och posttranslation histon modifieringar. Men embryon förvärva en ökande grad av cellulär heterogenitet som de utvecklas och kromatin profiler blir svårare att tolka. Lovande steg har tagits i Arabidopsis och Drosophila till vävnadsspecifikt profil kromatin landskap genom att extrahera cell typspecifika kärnor 38,39. Vår protokoll innehåller en nukleär extraktionssteg, vilket skulle kunna bana väg för vävnadsspecifika Chip-Seq i andra embryon.
The authors have nothing to disclose.
We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).
1/16 inch tapered microtip | Qsonica | 4417 | This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica. |
8 ml glass sample vial with cap | Wheaton | 224884 | 8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps. |
Adaptor | IDT or Sigma | NA | TruSeq universal adaptor,
AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACAC GACGCTCTTCCGATC*T. TruSeq indexed adaptor, P-GATCGGAAGAGCACACGTC TGAACTCCAGTCAC ‐NNNNNN‐ ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5' end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 µM) of the universal and the indexed adaptor and cooling them down slowly from 95 °C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 °C. |
b2g4pipe (software) | Blast2GO | non-commercial | http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip |
BLAST+ (software) | Camacho et al. | non-commercial | http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&DOC_TYPE=Download |
Bowtie (software) | Langmead et al. | non-commercial | http://bowtie-bio.sourceforge.net/index.shtml |
cisFinder (software) | Sharov et al. | non-commercial | http://lgsun.grc.nia.nih.gov/CisFinder/ |
Chip for capillary electrophoresis | Agilent Technologies | 5067-1504 | Load this chip with 1 µl DNA for library quality control. Store at 4 °C. |
Chip-based capillary electrophoresis system | Agilent Technologies | G2940CA | The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 °C. |
ChIP-Seq library preparation kit (KAPA Hyper Prep Kit) | Kapa Biosystems | KK8504 | Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 °C. |
ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit) | Rubicon Genomics | R40048 | Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 °C. |
Cluster3 (software) | de Hoon et al. | non-commercial | http://bonsai.hgc.jp/~mdehoon/software/cluster |
FastQC (software) | Simon Andrews | non-commercial | http://www.bioinformatics.babraham.ac.uk/projects/fastqc |
Fluorometer | life technologies | Q32866 | Qubit 2.0 Fluorometer |
Fluorometer reagents | life technologies | Q32851 | The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 °C, buffer and dye at room temperature. |
Formaldehyde | Sigma | F8775-4X25ML | Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic. |
Gel (E-Gel EX agarose , 2%) | life technologies | G4010 | Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature. |
Gel electrophoresis system | life technologies | G6465 | E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries. |
Gel extraction kit | Qiagen | 28706 | Store all reagents at room temperature. Use 500 µl of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice. |
HOMER (software) | Chris Benner | non-commercial | http://homer.salk.edu/homer/index.html |
Hybridization oven | Techne | FHB1D | Hybridizer HB-1D |
IGV (software) | Robinson et al. | non-commercial | http://www.broadinstitute.org/igv/home |
Illumina CASAVA-1.8 quality filter (software) | Assaf Gordon | non-commercial | http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter |
Java TreeView (software) | Alok Saldanha | non-commercial | http://jtreeview.sourceforge.net |
Laboratory jack | Edu-Lab | CH0642 | This jack is used to elevate sample in sound enclosure for sonication. |
Ladder, 100 bp | New England BioLabs | N3231 | Keep 1x solution at room temperature. Store stock at -20 °C. |
Ladder, 1 kb | New England BioLabs | N3232 | Keep 1x solution at room temperature. Store stock at -20 °C. |
Low-retention 1.5-ml microcentrifuge tubes | life technologies | AM12450 | nonstick, RNase-free microfuge tubes, 1.5 ml |
MACS2 (software) | Tao Liu | non-commercial | https://github.com/taoliu/MACS |
Magnetic beads | life technologies | 11201D | These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 11203D | These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 10001D | These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 10003D | These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 °C. |
Magnetic rack | life technologies | 12321D | DynaMag-2 magnet |
MEME | Bailey et al. | non-commercial | http://meme.nbcr.net/meme/ |
Na3VO4 | New England BioLabs | P0758 | Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 °C. |
NaF | New England BioLabs | P0759 | Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 °C. |
NGS machine | Illumina | SY-301-1301 | Genome Analyzer IIx |
NGS machine (high performance) | Illumina | SY-401-2501 | HiSeq |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2028 | Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2025 | Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2027 | Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Nucleic acid staining solution | iNtRON | 21141 | Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature. |
Orange G | Sigma | O3756-25G | 1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 °C. |
PCR primers | e.g., IDT or Sigma | NA | Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 µM each. Use 5 µl in a 50 µl PCR reaction. Store at -20 °C. |
MinElute PCR purification kit | Qiagen | 28006 | for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 °C, all other buffers and collection tubes at room temperature. |
Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9) | life technologies | AM9730 | Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 °C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible. |
Primer3 (software) | Steve Rozen & Helen Skaletsky | non-commercial | http://biotools.umassmed.edu/bioapps/primer3_www.cgi |
Protease inhibitor tablets | Roche | 11836170001 | cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 °C. |
Protease inhibitor tablets | Roche | 11873580001 | cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 °C. |
Proteinase K | life technologies | AM2548 | proteinase K solution (20 µg/µl). Store at -20 °C. |
RNase A | life technologies | 12091-039 | RNase A (20 µg/µl). Store at room temperature. |
Rotator | Stuart | SB3 | Rotator SB3 |
SAMtools (software) | Li et al. | non-commercial | http://samtools.sourceforge.neta |
Solid phase reversible immobilisation beads | Beckman Coulter | A63882 | The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 °C. |
Sonicator 3000 | Misonix/Qsonica | NA | Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin. |
Sound enclosure | Misonix/Qsonica | NA | optional: follow the manufacturer's recommendation to obtain the correct sound enclosure. |
Thermomixer | eppendorf | 22670000 | Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 °C above room temperature to 99 °C. |