(C I) Viral Mimik Poli ile Orta gebelik Sahnesi'nde Farelerde Anne Bağışıklık aktivasyonu indüksiyon
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
Maternal immün aktivasyon kavramı (MIA) otizm ve şizofreni 1 ile maternal enfeksiyon dernek epidemiyolojik çalışmalar kaynaklanır. Plasentanın veya maternal viral enfeksiyondan 2,3 sonrasında fetal beyninde tespit replike viral patojen olmaması, yavru enfeksiyon etkisi oldukça patojenlere kendisinden daha anne bağışıklık sisteminin aktivasyonu neden olduğu varsayılmaktadır .
polisitidilik asit: MIA ve psikiyatrik bozukluklar, kimyasal olarak sentezlenmiş viral taklit çift iplikli RNA Poliinosinik enjeksiyonu arasındaki neden-sonuç ilişkisini aydınlatmak için: Hamile kemirgenler içine (poli (C)) yaygın MIA için hayvan modeli olarak kullanılmıştır 4,5. Poli (I: C) Toll-benzeri reseptör 3 (TLR3) ve poli sistemik uygulama tarafından kabul edilmektedir (I: C) viral benzeri akut inflamatuar yanıtı indükler. mekanizmalardan biri olan poli (l: C) PRyavrularda oduces davranışsal anormallikler ve nöropatolojiler anne-plasental-fetal eksen 6 yanlısı ve anti-inflamatuvar sitokinlerin bir dengesizlik neden gereğidir. Çeşitli gruplar psikiyatrik bozuklukların 7 etiyolojisi anlamak için MIA modelini benimsedik ve bağlı araştırma grupları arasındaki farklı ilgi alanlarına, immün aktivasyon çeşitli zaman noktaları beyin gelişimi ve davranışları 7 farklı tedirginlikler elde etmek için kullanılmıştır.
, Embriyonik 12.5 gün hamile farelere başarıyla MIA davranışsal, nörolojik indükleyebilen olduğunu göstermiştir (E12.5), (C I) California Institute of Technology Paul H. Patterson laboratuvar poli enjekte stratejisini benimsemektedir ve otizm ve şizofreni 8-11 ile ilişkili çocuklarında immünolojik değişiklikler. Bizim önceki çalışmalar MIA yavrular davranışsal anormallikler (örneğin, sosyal impairmen görüntülemek göstermektedirt, iletişim eksikliği, tekrarlayan davranış, anksiyete gibi davranış ve gizli inhibisyon açığı 8,10,12), bağışıklık düzensizliği ve sitokinler dengesizlik 8,13,14, fetal beyin gen ifadesinin 15 değişmesi, lobule VII Purkinje hücresinin kaybı beyincik 11, hipokampus 9 sinaptik özelliklerinin değiştirilmesi, gen x çevre etkileşiminin 13, bağırsak geçirgenliğinin değiştirilmesi ve bağırsak Mikrobiyota kompozisyon 16. Bundan başka, tedavi edici ve önleyici stratejileri, bu model sistemi 13,16,17 arasında geliştirilmiştir. E12.5 MIA uyararak, diğerleri MIA serebral sinaptozomal moleküllerinin 17 fetal mikroglial aktivasyon ve bazal ön beyin 18 kolinerjik gelişimsel değişiklik, soy spesifik etkileşim 19, beyin beyin sinaptozomal ultrastrüktürel anormallikleri, beyin mitokondriyal solunum zinciri hiperfonksiyon abnormalties, infekte ürettiğini göstermiştir ,depresif benzeri davranışlar, biliş ve hipokampal uzun vadeli potensiyalizasyon (LTP) bozulma ve yetişkin hipokampal nöron 20 açığı.
(C I) yanı sıra, otizm ve şizofreni etiyolojisi incelemek için bu modeli uygulamak için nasıl paradigmaları Burada, poli tarafından E12.5 MIA ikna etmek nasıl ayrıntılı bir yöntem sağlar. MIA bozukluklarının 4 çeşitli bir risk faktörü olduğuna dikkat etmek önemlidir, ve sonuçları zaman ve indüksiyon yöntemi yanı sıra hamile barajlardan hayvancılık son derece duyarlıdır. Bu nedenle, laboratuarlar arasında bile küçük tutarsızlıklar genellikle düşük tekrarlanabilirlik ve / veya yavruda farklı fenotipleri neden olur. Bizim yöntem, özellikle otizm ve şizofreni için bir çevresel risk faktörü olarak MIA okuyan ilgilenenler için tasarlanmıştır ve ayrıntılı bir açıklama araştırmacılar verilerinin tekrarlanabilirlik geliştirmemize yardımcı olacaktır sağladı.
Protocol
Representative Results
Discussion
farklı zaman camlara MIA indüksiyon kemirgenlerde farklı beyin geliştirme etkinlikleri bozan ve dolayısıyla yavrularda farklı davranış anormallikleri ve nöropatolijilerin yol açar. E12.5 enjeksiyon: Burada, poli (Cı I) farelerde MIA uyarılması için bir protokol tarif. MIA indüksiyon Bu yöntem davranışsal, nörolojik, immünolojik ve yavrularda 8,10,11,16 yılında otizm ve şizofreni ile ilişkili gastrointestinal anormallikler yol açar. MIA bir çevresel risk faktörü olduğu için, dikk…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Biz MIA modeli, otizm ve şizofreni araştırma ilerleme katkılarından dolayı merhum Dr. Paul H. Patterson onurlandırmak istiyorum. Biz bu protokole onun büyük destek Sarkis K. Mazmanian kabul; idari yardım için Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni ve Leslie A. Neumann; filme yardım için Ali Khoshnan ve Jan C. Ko; MIA indüksiyon onların tavsiye için Elaine Y. Hsiao ve Natalia Malkova; kendi uzman hayvancılık için Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, ve Natalie A. Verduzco. Bu eser (Paul H. Patterson NIH 5P50MH086383-04) NIH Conte Merkezi Ödülü ile desteklenmiştir; Otizm (Paul H. Patterson # 7670) konuşuyor; (Sarkis K. Mazmanian için # 322839), Simons Vakfı; NIH Eğitim Grant (K.-HC NIH / NRSA T32GM07616); (ZY için) Caltech Yaz Lisans Araştırma Bursu (SURF); Amgen Akademisyenler Caltech'te (ZY için) Programı; ve Doktora Sonrası Araştırma Bursu from Ulusal Bilim Konseyi, Tayvan (MGK 101-2917-I-564-039 W.-LW için).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
References
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H. et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., & Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I. et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., & Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., & Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., & Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., & Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L. et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., & Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L. et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., & McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., & Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2 e98 (2012).
- Hsiao, E. Y. et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K. et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., & Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J. et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3 e240 (2013).
- Khan, D. et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4 e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., & Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B. et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U. et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S. et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., & Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., & Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
