Induzione di materna immunitario attivazione nei topi a Mid-gestazione stage con Viral Mimic poli (I: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
Il concetto di attivazione immunitaria materna (MIA) proviene dagli studi epidemiologici sulla associazione tra infezione materna con autismo e la schizofrenia 1. A causa dell'assenza di patogeni virali rilevabili replicanti nella placenta o cervello fetale dopo l'infezione virale materna 2,3, l'effetto dell'infezione sulla prole è ipotizzato essere causato dalla attivazione del sistema immunitario materno piuttosto che i patogeni stessi .
Per chiarire il rapporto causa-effetto tra MIA e disturbi psichiatrici, l'iniezione di sintesi chimica, virale mimica doppio polyinosinic RNA incagliato: acido policitidilico (poli (I: C)) in roditori in gravidanza è stato ampiamente utilizzato come modello animale per MIA 4,5. Poli (I: C) è riconosciuto da toll-like receptor 3 (TLR3), e la somministrazione sistemica di poli (I: C) induce risposta infiammatoria acuta virale simile. Uno dei meccanismi attraverso i quali poli (I: C) produces anomalie comportamentali e neuropatologie nella prole è causando uno squilibrio di citochine pro-infiammatorie e anti-nell'asse materno-placentare-fetale 6. Diversi gruppi hanno adottato il modello MIA per comprendere l'eziologia dei disturbi psichiatrici 7, ed a causa dei diversi interessi tra gruppi di ricerca, vari momenti di attivazione immunitaria sono stati utilizzati per ottenere diverse perturbazioni sullo sviluppo del cervello e comportamenti 7.
Il laboratorio di Paul H. Patterson presso il California Institute of Technology adotta la strategia di iniezione di poli (I: C) in topi incinta a embrionali 12,5 giorni (E12.5), che ha dimostrato con successo che MIA è in grado di indurre comportamentale, neurologica, e cambiamenti immunologici nella prole che sono associati con l'autismo e la schizofrenia 8-11. I nostri lavori precedenti mostrano che MIA prole visualizzare anomalie comportamentali (ad esempio, impairmen socialit, deficit di comunicazione, comportamento ripetitivo, comportamenti ansia-like, e latente deficit di inibizione 8,10,12), immunitario disregolazione e citochine squilibrio 8,13,14, alterazione del feto espressione genica del cervello 15, la perdita di cellule di Purkinje nel lobo VII di cervelletto 11, alterazione delle proprietà sinaptiche nell'ippocampo 9, l'interazione gene x ambiente 13, alterazione della permeabilità intestinale, intestino e la composizione del microbiota 16. Inoltre, strategie terapeutiche e profilattiche sono anche sviluppati da questa 13,16,17 sistema modello. Inducendo MIA a E12.5, altri hanno dimostrato che MIA produce attivazione della microglia fetale e colinergica alterazione dello sviluppo nel prosencefalo basale 18, ceppo specifico interazione 19, cervello sinaptosomiali cerebrale alterazioni ultrastrutturali, cerebrali respiratoria mitocondriale abnormalties catena iperfunzione, sottoregolazione di molecole sinaptosomiali cerebrali 17 ,comportamenti depressivi-like, compromissione della cognizione e ippocampo potenziamento a lungo termine (LTP) e deficit di adulti neurogenesi ippocampale 20.
Qui, forniamo un metodo dettagliato di come indurre MIA a E12.5 da poli (I: C), così come paradigmi di come applicare questo modello per studiare l'eziologia di autismo e la schizofrenia. È importante notare che MIA è un fattore di rischio per una varietà di disturbi 4, ed i suoi risultati sono estremamente sensibili al tempo e metodo di induzione e l'allevamento delle dighe in gravidanza. Come tale, anche incongruenze minori tra i laboratori spesso sfociano in bassa riproducibilità e / o differenti fenotipi nella prole. Il nostro metodo è specificamente progettato per chi è interessato a studiare MIA come un fattore di rischio ambientale per l'autismo e la schizofrenia, e la descrizione dettagliata fornita aiuterà i ricercatori a migliorare la riproducibilità dei dati.
Protocol
Representative Results
Discussion
MIA induzione a differenti finestre temporali perturba diversi eventi di sviluppo del cervello nei roditori, e di conseguenza porta a diverse anomalie comportamentali e neuropatologie nella prole. Qui, abbiamo descritto un protocollo per indurre MIA nei topi con poli (I: C) iniezione E12.5. Questo metodo di MIA induzione porta a comportamentale, neurologiche, immunologiche, e le anomalie gastrointestinali associati con l'autismo e la schizofrenia nella prole 8,10,11,16. È importante notare che, a causa M…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Vorremmo onorare il compianto Dr. Paul H. Patterson per il suo contributo al progresso del modello di MIA, l'autismo, la schizofrenia e la ricerca. Riconosciamo Sarkis K. Mazmanian per il suo grande sostegno su questo protocollo; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, e Leslie A. Neumann per l'assistenza amministrativa; Ali Khoshnan e Jan C. Ko per l'assistenza su riprese; Elaine Y. Hsiao e Natalia Malkova per i loro consigli su MIA induzione; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, e Natalie A. Verduzco per la loro zootecnia esperto. Questo lavoro è stato supportato dal NIH Conte Centro Award (NIH 5P50MH086383-04, di Paul H. Patterson); Autism Speaks (# 7670, di Paul H. Patterson); Simons Foundation (# 322839, a Sarkis K. Mazmanian); NIH Formazione Grant (NIH / RIV T32GM07616 a K.-HC); Caltech Estate Undergraduate Research Fellowship (SURF) (a ZY); Amgen Scholars Program al Caltech (a ZY); e Postdoctoral Fellowship from Consiglio Nazionale delle Scienze, Taiwan (NSC 101-2917-I-564-039, per W.-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
References
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H., et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I., et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L., et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L., et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. , (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31, 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2, e98 (2012).
- Hsiao, E. Y., et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K., et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J., et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3, e240 (2013).
- Khan, D., et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4, e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B., et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U., et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S., et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
