S. Cerevisiae 에서 Nsa1의 구조화 되지 않은 영역을 모델링 하는 데 작은 각 x 선 산란 된 x-선 결정학을 결합
Summary
이 방법은 엑스레이 결정학 및 소 각 x 선 산란 (SAXS), 복제, 표현, 및 구조 결심을 위한 재조합 Nsa1의 정화를 설명 하 고 다른 단백질의 하이브리드 구조 분석에 대 한 적용 둘 다를 포함 하는 주문 하 고 도메인을 난잡.
Abstract
리보솜 어셈블리 요소 Nsa1 Saccharomyces cerevisiae (S. cerevisiae) 에서 전체 길이 구조 결정은 무질서 때문에 도전 이다 고 정한 효소 단백질의 C-터미널. 이 원고는 엑스레이 결정학 및 SAXS에 의해 구조 분석에 대 한 S. cerevisiae 에서 재조합 Nsa1 정화 방법을 설명 합니다. X 선 결정학은 Nsa1의 정돈된 N 맨끝 WD40 도메인의 구조를 해결 하기 위해 활용 하 고 있다 그리고 SAXS 솔루션에서 Nsa1의 C-말단의 구조를 해결 하기 위해 사용 되었다. 솔루션 분산 데이터 솔루션에서 전체 길이 Nsa1에서 수집 되었다. 이론적인 산란 진폭 WD40 도메인의 고해상도 결정 구조에서 계산 그리고 경직 된 몸과 ab initio 모델링의 조합 Nsa1의 C-터미널. 이 하이브리드 접근 방식을 통해 전체 단백질의 제 사기 구조 개축 되었다. 여기에 제시 된 방법의 구조화 및 구조화 되지 않은 도메인의 혼합으로 구성 된 다른 단백질의 하이브리드 구조 결정에 대 한 일반적으로 적용 해야 합니다.
Introduction
리보솜 큰 ribonucleoprotein 기계 모든 살아있는 세포에 있는 단백질으로 번역 하는 mRNA의 필수적인 역할을 수행 하는. 리보솜 속1,2,,34나 복잡 한 과정에서 생산 되는 2 개의 소 단위 리보솜 구성 됩니다. 진 핵 리보솜 어셈블리 필수 ribosomal 어셈블리 요소2,,35의 수백의 도움에 의존합니다. Nsa1 (Nop7 관련 1)6큰 ribosomal 소 단위 생산에는 진 핵 리보솜 어셈블리 요소 이며 WD-반복으로 알려진 74 (WDR74) 더 높은 유기 체7에 포함 된입니다. WDR74 쥐8에서 blastocyst 형성에 필요한 것을 보여줘 왔다 그리고 WDR74 발기인은 자주 암 세포9에 돌연변이. 그러나, 함수 및 리보솜 어셈블리에 Nsa1/WDR74의 정확한 메커니즘 여전히 크게 불명 하다. 진 핵 리보솜 성숙 하는 동안 Nsa1/WDR74의 역할을 밝히기 시작, 여러 구조 분석 x 선 결정학 및 작은 각 엑스레이 뿌리기 (SAXS)10를 포함 하 여 수행 했다.
엑스레이 결정학, 핵 자기 공명 (NMR) 분광학, 전자 현미경, 고 SAXS 고분자 구조 공부를 위한 모든 중요 한 기술이 있습니다. 그러나 크기, 모양, 가용성, 및 구조 생물학 메서드는 특정 고분자 최고의 될 것입니다 적합 한 고분자 영향의 안정성, 지 고는 소위 “잡종” 접근 방식을 통해 여러 기술을 결합 한 점점 더 유익한 도구11. 특히 x 선 결정학 및 SAXS 고분자12의 구조 결정에 대 한 강력 하 고 상호 보완적인 방법이 있습니다.
결정학 고해상도 원자 구조 작은 분자에서 리보솜와 같은 큰 셀룰러 기계에 이르기까지 제공 하 고 단백질 등의 생물 학적 기능을 이해에서 수많은 혁신을 주도하 고 있다 고분자13. 또한, 구조 기반 약물 설계 약물 발견과 개발14에 중요 한 차원을 추가 하는 계산 방법으로 분자 도킹을 위한 크리스탈 구조의 힘을 하네스 랑. 그것의 광범위 한 적용에도 불구 하 고 유연 하 고 무질서 시스템은 결정학 크리스탈 패킹을 방해 수 있습니다 또는 전자 밀도 지도 완료 수 있습니다 이후 또는 품질의 평가에 도전. 반대로, SAXS 솔루션 기반 및 저해상도 구조적 접근 무질서 루프와 테르미니에서 본질적으로 무질서 단백질12,,1516에 이르기까지 유연한 시스템을 설명 하 수 이다. 그것은 광범위 한 입자 크기12와 호환을 고려, SAXS 작업할 수 있습니다 synergistically 결정학 구조 연구에 의해 해결 될 수 있는 생물 학적 질문의 범위를 확장.
Nsa1는 기능, 하지만 유연한 C-말단 엑스레이 결정학 방법을 의무가 아니다 뒤 체계적인된 WD40 도메인을 포함 하기 때문에 혼합 구조 방식을 위해 적당 하다. 다음은 복제, 표현, 그리고 하이브리드 구조 결정 엑스레이 결정학에 의해에 대 한 S. cerevisiae Nsa1 및 SAXS의 정화에 대 한 프로토콜. 이 프로토콜 순서와 무질서 지역 조합 구성 하는 다른 단백질의 구조 연구에 적응 될 수 있다.
Protocol
Representative Results
Discussion
이 프로토콜을 사용 하 여, S. cerevisiae 에서 재조합 Nsa1 엑스레이 결정학 및 SAXS에 의해 구조 연구에 대 한 생성 되었습니다. Nsa1은 솔루션에서 품행 되었고 여러 크리스탈 형태로 결정. 이러한 결정의 최적화 하는 동안 Nsa1의 C-말단 효소 저하에 과민 했다 발견 했다. 높은 해상도, orthorhombic 크리스탈 형태로 수만 중복 될 가능성이 Nsa1의 C-터미널 잘림 변형 Nsa1의 유연한 C terminus 크리스탈 패킹?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
회절 데이터 동남 지역 공동 액세스 팀 (SER-고양이) 22-ID와 22-BM beamlines에서 고급 광자 소스 (AP), Argonne 국립 연구소에서 수집 했다. SAXS 데이터 SIBYLS beamline에 사전 빛 소스 (ALS), 로렌스 버클리 국립 연구소에 수집 되었다. 우리는 직원에 대 한 그들의 원격 데이터 수집 및 처리 SIBYLS beamline에 감사 하 고 싶습니다. 우리는 국립 연구소의 환경 건강 과학 (NIEHS) 질량 분석 연구 및 지원 그룹 단백질 도메인 경계를 결정 하는 도움을 위한 감사. 이 작품으로 미국 국립 연구소의 건강 교내 연구 프로그램; 지원 미국 국립 연구소의 환경 건강 과학 (NIEHS)의 (R. E. S. 지아 ES103247)와 건강 연구 (CIHR, M.C.P에 146626)의 캐나다 학회. AP의 사용을 지원 했다 미국 에너지 부, 과학의 사무실, 사무실의 기본적인 에너지 과학 계약 번호에서 W-31-109-잉글랜드-38. 사용 고급 라이트 소스 (ALS)의 감독, 과학의 사무실, 사무실의 기본적인 에너지 과학, 계약 번호에서 미국 에너지 부의에 의해 지원 되었다 드-AC02-05CH11231입니다. 추가 지원 SIBYLS SAXS beamline 건강의 국립 연구소에서 유래에 대 한 프로젝트 노스 (R01GM105404)와 하이 엔드 계측 그랜트 S10OD018483. 우리는 또한이 원고에의 그들의 중요 한 독서에 대 한 안드레아 달과 박사 새 라 안 드레를 감사 하 고 싶습니다.
Materials
| Molecular Cloning of Nsa1 | |||
| pMBP2 parallel vector | Sheffield et al, Protein Expression and Purification 15, 34-39 (1999) | We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP) | |
| S. cerevisiae genomic DNA | ATCC | 204508D-5 | |
| Primers for cloning Nsa1 | |||
| SC_Nsa1_FLFw | IDT | CGC CAA AGG CCT ATGAGGTTACTAGTCAGCTGTGT GGATAG |
|
| SC_Nsa1_FLRv | IDT | AATGCAGCGGCCGCTCAAATTTT GCTTTTCTTACTGGCTTTAGAAGC AGC |
|
| SC_Nsa1_DeltaCFw | IDT | GGGCGCCATGGGATCCATGAGG TTACTAGTCAGCTGTGTGG |
|
| SC_Nsa1_DeltaCRv | IDT | GATTCGAAAGCGGCCGCTTAAAC CTTCCTTTTTTGCTTCCC |
|
| Recombinant Protein Production and Purification of Nsa1 | |||
| Escherichia coli BL21 (DE3) Star Cells | Invitrogen | C601003 | |
| pMBP- NSA1 and various truncations | Lo et al., 2017 | ||
| Selenomethionine | Molecular Dimensions | MD12-503B | |
| IPTG, Dioxane-Free | Promega | V3953 | |
| EDTA Free Protease Inhibitor Cocktail | Sigma-Aldrich | 4693159001 | |
| Sodium Chloride | Caledon Laboratory Chemicals | 7560-1-80 | |
| Magnesium Chloride hexahydrate | Sigma-Aldrich | M2670 | |
| Tris Buffer, 1 M pH7.5 | KD Medical | RGF-3340 | |
| Glycerol | Invitrogen | 15514-029 | |
| beta-mercaptoethanol | Sigma | M6250 | |
| 1M Imidazole, pH 8.0 | Teknova | I6980-06 | |
| Talon Affinity Resin | Clonetech | 635503 | |
| Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K) | Millipore | UFC901024 | |
| HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column | GE-Healthcare | 28989335 | |
| TEV Protease | Prepared by NIEHS Protein Expression Core | Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009) | |
| 4-15% Mini-PROTEAN TGX Precast Protein Gels | BioRad | 456-8056 | |
| Crystallization, Proteolytic Screening | |||
| Crystal Screen | Hampton Research | HR2-110 | |
| Crystal Screen 2 | Hampton Research | HR2-112 | |
| Salt Rx | Hampton Research | HR2-136 | |
| Index Screen | Hampton Research | HR2-144 | |
| PEG/Ion Screen | Hampton Research | HR2-139 | |
| JCSG+ | Molecular Dimensions | MD1-37 | |
| Wizard Precipitant Synergy | Molecular Dimensions | MD15-PS-T | |
| Swissci 96-well 3-drop UVP sitting drop plates | TTP Labtech | 4150-05823 | |
| 3inch Wide Crystal Clear Sealing Tape | Hampton Research | HR4-506 | |
| Proti-Ace Kit | Hampton Research | HR2-429 | |
| PEG 1500 | Molecular Dimensions | MD2-100-6 | |
| PEG 400 | Molecular Dimensions | MD2-100-3 | |
| HEPES/sodium hydroxide pH 7.5 | Molecular Dimensions | MD2-011- | |
| Sodium Citrate tribasic | Molecular Dimensions | MD2-100-127 | |
| 22 mm x 0.22 mm Siliconized Coverslides | Hampton Research | HR3-231 | |
| 24 Well Plates with sealant (VDX Plate with Sealant) | Hampton Research | HR3-172 | |
| 18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM) | Hampton Research | HR4-945, HR4-947, HR4-970, HR4-971 | |
| Seed Bead Kit | Hampton Research | HR2-320 | |
| Magnetic Crystal Caps | Hampton Research | HR4-779 | |
| Magnetic Cryo Wand | Hampton Research | HR4-729 | |
| Cryogenic Foam Dewar | Hampton Research | HR4-673 | |
| Crystal Puck System | MiTeGen | M-CP-111-021 | |
| Full Skirt 96 well Clear Plate | VWR | 10011-228 | |
| AxyMat Sealing Mat | VWR | 10011-130 | |
| Equipment | |||
| UVEX-m | JAN Scientific, Inc. | ||
| Nanodrop Lite Spectrophotometer | Thermo-Fisher | ||
| Mosquito Robot | TTP Labtech | ||
| Software/Websites | |||
| HKL2000 | Otwinoski and Minor, 1997 | ||
| Phenix | Adams et al., 2010 | ||
| Coot | Emsley et al., 2010 | ||
| ATSAS | Petoukhov et al., 2012 | https://www.embl-hamburg.de/biosaxs/atsas-online/ | |
| Scatter | Rambo and Tainer, 2013 | ||
| Pymol | The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC. | ||
| BUNCH | Petoukhov and Svergun, 2005 | ||
| CRYSOL | Svergun et al, 1995 | ||
| PRIMUS | Konarev et al, 2003 | ||
| EOM | Tria et al, 2015 |
References
- Thomson, E., Ferreira-Cerca, S., Hurt, E. Eukaryotic ribosome biogenesis at a glance. J Cell Sci. 126 (Pt 21), 4815-4821 (2013).
- Woolford, J. L., Baserga, S. J. Ribosome biogenesis in the yeast Saccharomyces cerevisiae. 유전학. 195 (3), 643-681 (2013).
- Kressler, D., Hurt, E., Bassler, J. A Puzzle of Life: Crafting Ribosomal Subunits. Trends Biochem Sci. , (2017).
- Tomecki, R., Sikorski, P. J., Zakrzewska-Placzek, M. Comparison of preribosomal RNA processing pathways in yeast, plant and human cells – focus on coordinated action of endo- and exoribonucleases. FEBS Lett. , (2017).
- Kressler, D., Hurt, E., Bassler, J. Driving ribosome assembly. Biochim Biophys Acta. 1803 (6), 673-683 (2010).
- Kressler, D., Roser, D., Pertschy, B., Hurt, E. The AAA ATPase Rix7 powers progression of ribosome biogenesis by stripping Nsa1 from pre-60S particles. J Cell Biol. 181 (6), 935-944 (2008).
- Hiraishi, N., Ishida, Y., Nagahama, M. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74. Biochem Biophy Res Co. 467 (3), 534-540 (2015).
- Maserati, M., et al. Wdr74 is required for blastocyst formation in the mouse. PLoS One. 6 (7), e22516 (2011).
- Weinhold, N., Jacobsen, A., Schultz, N., Sander, C., Lee, W. Genome-wide analysis of noncoding regulatory mutations in cancer. Nat Genet. 46 (11), 1160-1165 (2014).
- Lo, Y. H., Romes, E. M., Pillon, M. C., Sobhany, M., Stanley, R. E. Structural Analysis Reveals Features of Ribosome Assembly Factor Nsa1/WDR74 Important for Localization and Interaction with Rix7/NVL2. Structure. 25 (5), 762-772 (2017).
- Lander, G. C., Saibil, H. R., Nogales, E. Go hybrid: EM, crystallography, and beyond. Curr Opin Struc Biol. 22 (5), 627-635 (2012).
- Putnam, C. D., Hammel, M., Hura, G. L., Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Q Rev Biophys. 40 (3), 191-285 (2007).
- Jaskolski, M., Dauter, Z., Wlodawer, A. A brief history of macromolecular crystallography, illustrated by a family tree and its Nobel fruits. FEBS J. 281 (18), 3985-4009 (2014).
- Zheng, H., et al. X-ray crystallography over the past decade for novel drug discovery – where are we heading next?. Expert Opin Drug Dis. 10 (9), 975-989 (2015).
- Kikhney, A. G., Svergun, D. I. A practical guide to small angle X-ray scattering (SAXS) of flexible and intrinsically disordered proteins. FEBS Lett. 589 (19 Pt A), 2570-2577 (2015).
- Bernado, P., Mylonas, E., Petoukhov, M. V., Blackledge, M., Svergun, D. I. Structural characterization of flexible proteins using small-angle X-ray scattering. J Am Chem Soc. 129 (17), 5656-5664 (2007).
- Sheffield, P., Garrard, S., Derewenda, Z. Overcoming expression and purification problems of RhoGDI using a family of “parallel” expression vectors. Protein Expres Purif. 15 (1), 34-39 (1999).
- Doublie, S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 276, 523-530 (1997).
- Tropea, J. E., Cherry, S., Waugh, D. S. Expression and purification of soluble His(6)-tagged TEV protease. Methods Mol Biol. 498, 297-307 (2009).
- Wlodawer, A., Minor, W., Dauter, Z., Jaskolski, M. Protein crystallography for aspiring crystallographers or how to avoid pitfalls and traps in macromolecular structure determination. FEBS J. 280 (22), 5705-5736 (2013).
- Otwinowski, Z., Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Macromolecular Crystallography, Pt A. 276, 307-326 (1997).
- Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D. 66 (Pt 2), 213-221 (2010).
- Winn, M. D., et al. Overview of the CCP4 suite and current developments. Acta Crystallogr D. 67 (Pt 4), 235-242 (2011).
- Terwilliger, T. C., et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallographica Section D. 65, 582-601 (2009).
- Emsley, P., Lohkamp, B., Scott, W. G., Cowtan, K. Features and development of Coot. Acta Crystallogr D. 66 (Pt 4), 486-501 (2010).
- Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D. 68 (Pt 4), 352-367 (2012).
- McCoy, A. J. Solving structures of protein complexes by molecular replacement with Phaser. Acta Crystallogr D. 63 (Pt 1), 32-41 (2007).
- McCoy, A. J., et al. Phaser crystallographic software. J Appl Crystallogr. 40 (Pt 4), 658-674 (2007).
- Dyer, K. N., et al. High-throughput SAXS for the characterization of biomolecules in solution: a practical approach. Methods Mol Biol. 1091, 245-258 (2014).
- Forster, S., Apostol, L., Bras, W. Scatter: software for the analysis of nano- and mesoscale small-angle scattering. J Appl Crystallogr. 43, 639-646 (2010).
- Petoukhov, M. V., et al. New developments in the ATSAS program package for small-angle scattering data analysis. J Appl Crystallogr. 45, 342-350 (2012).
- Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J., Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J Appl Crystallogr. 36, 1277-1282 (2003).
- Svergun, D. I. Determination of the Regularization Parameter in Indirect-Transform Methods Using Perceptual Criteria. J Appl Crystallogr. 25, 495-503 (1992).
- Rambo, R. P., Tainer, J. A. Accurate assessment of mass, models and resolution by small-angle scattering. Nature. 496 (7446), 477-481 (2013).
- Petoukhov, M. V., Svergun, D. I. Global rigid body modeling of macromolecular complexes against small-angle scattering data. Biophys J. 89 (2), 1237-1250 (2005).
- Tria, G., Mertens, H. D., Kachala, M., Svergun, D. I. Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering. IUCrJ. 2 (Pt 2), 207-217 (2015).
- Svergun, D., Barberato, C., Koch, M. H. J. CRYSOL – A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J Appl Crystallogr. 28, 768-773 (1995).
- . The PyMOL Molecular Graphics System Version 1.8 Available from: https://pymol.org (2015)
- Pelikan, M., Hura, G. L., Hammel, M. Structure and flexibility within proteins as identified through small angle X-ray scattering. Gen Physiol Biophys. 28 (2), 174-189 (2009).
- Deller, M. C., Kong, L., Rupp, B. Protein stability: a crystallographer’s perspective. Acta Crystallogr F. 72 (Pt 2), 72-95 (2016).
- Hinsen, K. Structural flexibility in proteins: impact of the crystal environment. Bioinformatics. 24 (4), 521-528 (2008).
- Shtykova, E. V., et al. Structural analysis of influenza A virus matrix protein M1 and its self-assemblies at low pH. PLoS One. 8 (12), e82431 (2013).
- Mallam, A. L., et al. Solution structures of DEAD-box RNA chaperones reveal conformational changes and nucleic acid tethering by a basic tail. Proc Natl Acad Sci U S A. 108 (30), 12254-12259 (2011).
- Papaleo, E., et al. The Role of Protein Loops and Linkers in Conformational Dynamics and Allostery. Chem Rev. 116 (11), 6391-6423 (2016).
- Rozycki, B., Boura, E. Large, dynamic, multi-protein complexes: a challenge for structural biology. J Phys Condens Matter. 26 (46), 463103 (2014).
- Schlundt, A., Tants, J. N., Sattler, M. Integrated structural biology to unravel molecular mechanisms of protein-RNA recognition. Methods. 118, 119-136 (2017).
- Thompson, M. K., Ehlinger, A. C., Chazin, W. J. Analysis of Functional Dynamics of Modular Multidomain Proteins by SAXS and NMR. Methods Enzymol. 592, 49-76 (2017).
