Repressão de crescimento de células do mieloma múltiplo na Vivo por nanotubo de carbono de parede simples (SWCNT)-entregue MALAT1 antisentido Oligos
Summary
Este manuscrito descreve a síntese de um nanotubo de carbono de parede simples (SWCNT)-conjugado MALAT1 gapmer antisentido DNA do oligonucleotide (SWCNT-anti-MALAT1), que demonstra a entrega confiável do SWCNT e o potente efeito terapêutico de anti-MALAT1 in vitro e in vivo. Métodos utilizados para síntese, modificação, conjugação, e injeção de SWCNT-anti-MALAT1 são descritos.
Abstract
O nanotubo de carbono de parede simples (SWCNT) é um novo tipo de nanopartículas, que tem sido usado para entregar vários tipos de drogas em células, como proteínas, oligonucleotides e drogas sintéticas da pequeno-molécula. O SWCNT tem dimensões personalizáveis, uma grande área superficial e com flexibilidade pode vincular com drogas através de diferentes modificações na sua superfície; Portanto, é um sistema ideal para o transporte de drogas em células. Há muito tempo não codificante RNAs (lncRNAs) são um conjunto de RNA não-codificante mais de 200 nt, que não pode ser convertido em proteína, mas desempenham um papel importante nos processos biológicos e fisiopatológicos. Transcrição de adenocarcinoma do pulmão metástase-associado 1 (MALAT1) é uma lncRNA altamente conservada. Foi demonstrado que níveis mais elevados de MALAT1 estão relacionados com o mau prognóstico de vários tipos de câncer, incluindo mieloma múltiplo (MM). Temos revelou que MALAT1 regula a morte de reparação e célula de DNA em MM; assim, o MALAT1 pode ser considerado como um alvo terapêutico para MM. No entanto, a entrega eficiente do oligo antisentido para inibir/nocaute MALAT1 in vivo ainda é um problema. Neste estudo, podemos modificar o SWCNT com PEG-2000 e conjugado um oligo anti-MALAT1 para isso, testar a entrega deste composto em vitro, injetá-lo por via intravenosa em um modelo de mouse MM disseminado e observar uma significativa inibição da progressão de MM, o que indica Esse SWCNT é um vaivém de entrega ideal para gapmer anti-MALAT1 DNA.
Introduction
O SWCNT é um romance nanomaterial que pode fornecer vários tipos de drogas, tais como pequenas moléculas, proteínas e ácidos nucleicos, estàvel e eficientemente com ideal tolerabilidade e toxicidade mínima em vitro1 e2de in vivo. Um SWCNT funcionalizado tem grande solubilidade em água e biocompatibilidade, pode ser usado como um serviço de transporte para moléculas menores e pode transportá-los para penetrar a membrana celular3,4,5.
lncRNAs são um aglomerado de RNA (> 200 nt) que são transcritas do genoma de mRNA, mas não pode ser traduzido em proteínas. Aumentando a evidência mostrou que lncRNAs participar na regulação da expressão de gene6 e estão envolvidas na iniciação e progressão da maioria dos tipos de câncer, incluindo MM7,8,9. MALAT1 é uma transcrição não-codificante nuclear enriquecido 2 (NEAT2) e um altamente conservadas lncRNA10. MALAT1 é inicialmente reconhecido em metastásico pulmão não-pequenas células de câncer (NSCLC)11, mas tem sido overexpressed em inúmeros tumores5,12,13; é um do mais altamente expressa lncRNAs e está correlacionada com um prognóstico pobre em MM8,14. O nível de expressão de MALAT1 é significativamente maior nos pacientes MM extra-medulares curso fatal em relação aos diagnosticados apenas como MM15.
Em um estudo anterior, confirmamos que anti-MALAT1 oligos robustamente originar danos ao DNA e apoptose em MM16 usando oligonucleotides antisentido de DNA de gapmer MALAT1 de segmentação (anti-MALAT1) em células MM. O DNA de gapmer é composto de DNA antisentido e ligado por 2′-OMe-RNAs, que poderiam solicitar MALAT1 de clivagem por RNase H atividade uma vez acoplada17. A eficiência de entrega in vivo de oligos antisentidos ainda limita seu uso clínico.
Para testar a entrega o efeito de SWCNT para anti-MALAT1 gapmer oligos, o anti-MALAT1 gapmer DNA é conjugado a DSPE-PEG2000-amina acrescida SWCNT. O SWCNT-anti-MALAT1 então é injetado por via intravenosa em um modelo de rato disseminadas MM; observa-se uma inibição marcante depois de quatro tratamentos.
Protocol
Representative Results
Discussion
A evidência mostrou que lncRNAs participar na regulação de numerosos processos fisiológicos e fisiopatológicos em cânceres, incluindo MM7,8,9; Eles têm o potencial para ser direcionado para o tratamento de câncer, que pode ser realizado por oligonucleotides antisentido20,21,22. O E.U. Food and Drug Administration (FDA) aprovou v…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Os autores agradecer o Lerner Research Institute proteômica, genômica e núcleos de imagens para sua assistência e apoio. Financiamento: Este trabalho é apoiado financeiramente pelo NIH/ICN grant R00 CA172292 (J.J.Z.) e fundos de start-up (para J.J.Z.) e clínica e translacional ciência colaborativa (CTSC) do caso Western Reserve University núcleo utilização piloto Grant (para J.J.Z.). Este trabalho utilizou o microscópio confocal Leica SP8 que foi comprado com financiamento da concessão de institutos nacionais de saúde SIG 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
