דיכוי צמיחת תאים מיאלומה In Vivo על ידי ננו-צינורית פחמן קיר אחד (SWCNT)-נמסר MALAT1 Antisense Oligos
Summary
כתב יד זה מתאר את הסינתזה של ננו-צינורית פחמן קיר אחד (SWCNT)-מצומדת MALAT1 antisense gapmer דנ א oligonucleotide (SWCNT-נגד-MALAT1), אשר מדגים מסירת SWCNT אמין, חזק טיפולית והשפעת anti-MALAT1 במבחנה, ויוו. שיטות להשתמש של סינתזה, שינוי, ההטיה, הזרקה של SWCNT-נגד-MALAT1 מתוארים.
Abstract
ננו-צינורית פחמן קיר אחד (SWCNT) הוא סוג חדש של ננו-חלקיק, אשר שימש כדי לספק מספר סוגי סמים לתוך תאים, כגון חלבונים, oligonucleotides, תרופות סינתטיות מולקולה קטנה. SWCNT המימדים הניתנות להתאמה אישית, שטחי אזור גדול, באפשרותך לאגוד בגמישות עם סמים דרך שינויים שונים על פני השטח שלו; לכן, זה מערכת אידיאלי להעברת סמים לתוך התאים. זמן noncoding RNAs (lncRNAs) הם מקבץ של יותר מ 200 noncoding RNA nt, אשר לא יכול להיות מתורגם לחלבון אבל יש תפקיד חשוב בתהליכים ביולוגיים, הקשורים pathophysiological. גרורות-הקשורים ריאות אדנוקרצינומה התעתיק 1 (MALAT1) הוא lncRNA שנשמרת מאוד. הוכח כי רמות MALAT1 גבוהות קשורות על פרוגנוזה גרועה סוגי סרטן שונים, לרבות מיאלומה נפוצה (מ מ). נחשפו MALAT1 מווסת את תיקון ה-DNA ומוות תא מ מ; לפיכך, MALAT1 יכול להיחשב מטרה טיפולית עבור מ מ. עם זאת, oligo antisense מסירת יעיל כדי לעכב/נוקאאוט MALAT1 ויוו היא עדיין בעיה. במחקר זה, לנו לשנות את SWCNT עם פג-2000 ו נזווג oligo anti-MALAT1 אליו לבדוק את המשלוח של מתחם זה במבחנה, תזריק את זה דרך הווריד למודל בעכבר של מ מ המופץ, להתבונן על עיכוב משמעותי של התקדמות מ מ, אשר מציינת SWCNT הזה הוא הסעה משלוח אידיאלי עבור gapmer אנטי-MALAT1 ה-DNA.
Introduction
SWCNT הוא nanomaterial חדשניים שיכולים לספק סוגים שונים של תרופות, כגון חלבונים, מולקולות קטנות, חומצות גרעין, stably וביעילות עם סבילות אידיאלי, רעילות מינימלית חוץ גופית1 וויוו2. SWCNT functionalized יש נהדר מסיסות הביו ומים, יכול לשמש הסעות עבור מולקולות קטנות יותר, והוא מסוגל לשאת להן לחדור את קרום התא3,4,5.
lncRNAs הם מקבץ של RNA (> 200 nt) זה משוקלטים מן הגנום ל mRNA אבל לא ניתן היה לתרגם את החלבונים. הוכחה גוברת הראו כי lncRNAs להשתתף ברגולציה של ביטוי גנים6 , מעורבים החניכה, התקדמות של רוב סוגי סרטן, כולל מ מ7,8,9. MALAT1 הוא תעתיק noncoding גרעיני מועשר 2 (NEAT2), מאוד שנשמרת lncRNA10. MALAT1 מזוהה בתחילה ריאות שאינם קטנים התא גרורתית סרטן (NSCLC)11, אבל יש כבר overexpressed רבים גידולים5,12,13; הוא נחשב לאחד lncRNAs ביטוי ביותר, הוא מתואם עם פרוגנוזה גרועה מ מ8,14. רמת הביטוי של MALAT1 גבוה משמעותית בחולים קורס קטלני extramedullary מ”מ לעומת אלו שאובחנו רק מ מ15.
במחקר הקודם, יש לנו אישר כי אנטי-MALAT1 oligos robustly לגרום נזק לדנ א אפופטוזיס מ מ16 באמצעות gapmer DNA antisense oligonucleotides מיקוד MALAT1 (אנטי-MALAT1) בתאים מ מ. ה-DNA gapmer המורכב antisense DNA, מקושרים על ידי 2′-הביתה-RNAs, אשר יכול לבקש MALAT1 המחשוף מאת RNase H פעילות פעם מאוגד17. יעילות משלוח ויוו antisense oligos עדיין מגבילה את השימוש הקליני.
כדי לבדוק את המשלוח אפקט של SWCNT אנטי-MALAT1 gapmer oligos, gapmer אנטי-MALAT1 ה-DNA היא מצומדת כדי DSPE-PEG2000-אמין functionalized SWCNT. SWCNT-נגד-MALAT1 מכן מוזרק לווריד מודל העכבר המופץ מ מ; עיכוב בולט הוא ציין לאחר ארבעה טיפולים.
Protocol
Representative Results
Discussion
הראיות הוכיחו כי lncRNAs לקחת חלק מרכזי בויסות פיזיולוגיים רבים ושגרות pathophysiological ב סרטן, כולל7,מ מ8,9; יש להם פוטנציאל להיות ממוקד לטיפול בסרטן, אשר יכול להתממש מאת antisense oligonucleotides20,21,22. המזון ו?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
המחברים תודה את המכון לחקר לרנר פרוטיאומיה מבנית, גנומית, ואת ההדמיה ליבות לסיוע שלהם ותמיכה. מימון: עבודה זו נתמכה כלכלית על ידי NIH/NCI מענק R00 CA172292 (J.J.Z.) ואת ראשונית (ל J.J.Z.) ואת קלינית Translational המדע שיתופית (CTSC) של התיק Western Reserve אוניברסיטת הליבה ניצול טייס גרנט (ל J.J.Z.). עבודה זו מנוצל מיקרוסקופ קונפוקלי SP8 לייקה אשר נרכש עם מימון מוסדות לאומיים של בריאות סיג גרנט 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
