준비 및 Nonhuman 영장류 조 혈 줄기와 조상 세포의 유전자 수정
Summary
이 프로토콜의 목표 nonhuman 영장류 CD34 분리 하는+ 세포 액된 골, 유전자-수정 lentiviral 벡터와이 셀 하 고 주입 헌 호스트에 대 한 제품을 준비에서. 총 프로토콜 길이 약 48 h입니다.
Abstract
조 혈 줄기와 조상 세포 (HSPC) 이식 백혈병에 대 한 초석 치료와 거의 반세기 동안 다른 암, 인간 면역 결핍 바이러스 (hiv-1) 감염의 유일한 알려진된 치료의 기초가 되었으며에 엄청난 약속을 보여줍니다. 베타 thalassemia 같은 유전 질환의 치료. 우리의 그룹 많은 같은 시 약 및 병원에 적용 되는 기술을 최적화 하는 과학자를 허용 nonhuman 영장류 (NHPs)에 모델 HSPC 유전자 치료 프로토콜을 개발 했습니다. 여기, 우리는 CD34 정화 방법 설명+ HSPCs 및 장기적인 유지 액된 골 (BM)에서 조 혈 줄기 세포 (HSC) 하위 집합. 다른 HSPC 소스 (예: 동원된 주변 혈액 줄기 세포 [PBSCs])의 정화에 대 한 동일한 기법을 사용할 수 있습니다. 설명 하는 것은 2 일 프로토콜 있는 셀은 정화, 교양, lentivirus (LV), 수정 및 헌 호스트에 다시 주입에 대 한 준비. 성공의 주요 정보는 CD34의 순도 포함+ HSPC 인구, 반 고체 미디어, 그리고 가장 중요 한 것은, 진 수정 효율에 형태학 상으로 다른 식민지를 형성 하는 순화 된 HSPCs의 기능. HSPC 유전자 치료의 주요 장점은 모든 조 혈 세포 종류를 수명이 긴 세포의 소스를 제공 하는 기능입니다. 따라서, 이러한 방법은 암, 유전 질환 및 전염 성 질환에 대 한 모델 치료에 사용 되었습니다. 각각의 경우에서 치료 효능 붉은 혈액 세포, T 세포, B 세포, 및 골수성 하위 집합을 포함 하 여 고유 HSPC 자손의 기능을 강화 하 여 설정 됩니다. 를 분리 하는 방법을 수정 하 고 준비 HSPC 제품은 직접 적용 및 번역 인간 환자에서 여러 질병에.
Introduction
줄기 세포 유전자 치료 인간 병 리의 넓은 범위를 해결 하는 강력한 수단 이다. HSPC 유전자 치료는 특히 매력적인 접근 이다, i) 상대적으로 완화의 환자에서 이러한 셀을 수집 ii) 사용할 수 셀 표면 고기 및 ex vivo 문화 매개 변수 이며, 필드와 확장, 지식 재산 때문 때문에 iii) 과학자 들은 유전자 수정 전략 관심의 다양 한 질병에 맞게 늘어나는 도구 상자와 함께 제공. 우리는 적극적으로 HSPC 생물학, 유전자 수정 HSPCs 전 임상 생체 조건 모델에서의 engraftment 및 관련 환자 인구를 응용 프로그램의 기초 과학을 포함 하 여 여러 각도에서 HSPC 유전자 치료 접근을 조사 하고있다. 우리와 다른 기능적으로 뚜렷한 HSPC 하위 집합1,2,3, 동원 및 컨디셔닝 regimens HSPC 수율 및 최소화 하면서 engraftment를 극대화 하는 세포 표면 표현 형 특징 있다 독성4,5, 그리고 유전자 수정 및 다양 한 악성, 유전, 그리고 전염병6,7,8,를 맞게 되었습니다 유전자 편집 전략 9,10. 쥐, 개, NHPs를 포함 한 작은 큰-동물 모델의 여러에서 기능과 유전자 수정 HSPCs의 engraftment를 평가할 수 있습니다. 특히, NHP 모델은 많은 시 약, 예를 들어 CD34 CD90, 같은 HSPC 세포 표면 단백질을 위한 특정 항 체를 번갈아 인간과 NHP 셀에 사용할 수 있기 때문에 유리. 또한, 마우스, 달리 NHPs 같은 큰 동물 허용 가까이 근사 유전자 수정의 규모의 임상 효능에 필요한. 마지막으로, NHPs 에이즈-1 감염11 같은 인간의 병 리 모델링에 대 한 황금 표준 고 후보 항 암 및 항 HIV immunotherapies12,13신흥 모델 시스템입니다.
이 프로토콜의 목적은 NHP HSPC 주입 제품 준비 및 정화, 유전자 수정 방법 개요입니다. 이 프로토콜의 범위 밖에 서 우리는 이전에 표시 있지만 이러한 제품 헌 NHP 호스트에서 engraft 모든 조 혈 계보, 하 고 질병 모델1의 광범위 한 범위에서 치료 효능을 제공 합니다. 우리 또한 engrafting HSPCs의 clonality를 특징 하 고 속도 론, 매매, 및 개별 HSPCs 및 그들의 자손, 다음 헌 이식1,14형 추적 플랫폼을 구축. 여기에 제시 된 방법은 다음과 같은 목표와 함께 개발 되었습니다: i)를 매우 순수한 HSPCs 장기 engrafting HSC 하위 집합, ii) 게 유지와 ex vivo 문화, 동안 원시 HSCs iii)를 효율적으로 유전자-수정 중 대량 HSPCs 격리 또는 장기 HSC 하위 집합 engrafting 형광 활성화 된 세포 (FACS), 격리 phenotypically/기능적으로 뚜렷한 HSPC 인구, 많은 그룹2,15의 방법으로 일관 된 정렬 뿐만 아니라 자기 기반 셀 정렬 (맥)을 고용 16. 문화에 기본 HSCs의 유지 보수 (즉, 림프 및 골수성 하위 집합을 분화 완전 하 일으키 다하고 창시자로이 세포의 분화를 최소화) 여기에 설명 된 프로토콜의 필수적인 일 면 이다. 비록 우리는 원시적인 형17,18, 여기, 유지 하면서 HSPCs를 확장 하는 접근을 특징 이전는 최소한의 (48 h) 통해 HSCs를 유지에 초점을 맞추고와 ex vivo 문화 정의 하는 프로토콜을 설명 합니다.
HSPCs 및 HSC의 효율적인 수정 하위 집합이이 프로토콜의 중앙 목표 이다. 몇 가지 방법을 우리는 보고, 중 2 개는 지금까지 가장 조사에서 임상 시험: LV 중재 유전자 수정 및 편집1,,619nuclease 중재 하는 유전자. 유전자 편집 전략 특히 관심의 대상된 유전자 수정 nuclease 플랫폼의 수 중 하나를 사용, 예를 들어 C C chemokine 수용 체 타입-5 (CCR5) 치료에 대 한 HIV 감염7,19 또는 Bcl11A의 치료에 대 한 hemoglobinopathies6의. 여기, 우리는 유전자 변형 화물 통합 semirandomly 게놈1,,820LV 중재 유전자 수정에 집중 한다. LV 방식의 주요 장점은 (최대 8 또는 9 kilobases) 유전 물질의 대용량을 제공 하는 능력입니다. 유전자 편집 전략 transgene 지정 된 장소에만 통합 하는 관심의 대상으로 동종 기증자 재결합 (HDR)에 의해 개발 되고있다, 하지만 이러한 방법을 더 생체 외에서 그리고 작은 동물 모델 개발이 필요 합니다. 대조적으로, LV 벡터 사용 되었습니다 광범위 하 게 NHPs와 환자21,22. 중요 한 것은, 사용 하는 시작 HSPC 소스로 BM 액, 여기에 설명 된 프로토콜 적응 수 있다 수 쉽고 광범위 하 게, 예를 들어 PBSCs을. 위에서 설명한 대로 우리 두 종에 적용 되는 시 약을 사용 하 여 NHPs와 인간 사이의 유전적 유사성의 높은 학위의 활용. 마지막으로,이 이렇게 맞게 조정 되었습니다 다른 조 혈 하위 집합, 즉 T 세포12,,2324; 수정 하 효과 T 세포 immunotherapy 접근의 출현이이 프로토콜에서 동일한 LV 플랫폼 무 겁 게 의존 하고있다. 이러한 메서드는 모든 연구원 HSPC 생물학 또는 LV 중재 유전자 수정에 적합 합니다. 여기에 제시 된 HSPC 정화 프로토콜 소설 HSC 농축 하위 집합의 특성을 사용 하는 수 예를 들어 앞에서 설명한1,,1525. 마찬가지로, 여기에 제시 하는 방법 수 마찬가지로 LV 변환 적용 되며 다른 수많은 세포 유형 및 실험적인 질문, 둘 다 생체 외에서 그리고 vivo에서 모델에 대 한 개발.
요약 하자면, 우리는 분리 및 유전자 NHP HSPCs를 수정 하는 방법을 제시. 이러한 메서드는 다른 종 및 HSPCs의 다른 소스에 쉽게 적용할 수 있습니다. 이 철저 하 게 검증 된 프로토콜 수많은 인간의 질병에 대 한 효과가 치료의 모델링에 큰 약속을 보여줍니다.
Protocol
Representative Results
Discussion
LV 벡터 엔지니어링은 유전자 수정 CD34 셀 유형 베스트 특징이 방법+ HSPCs, 이후 이식 vivo에서. 여기에 설명 된 프로토콜은 유전자 수정 HSPCs, vivo에서 장기 유지의 수를 극대화 하 고 다양 한 악성, 감염 및 유전 질환을 가진 환자에 게 임상 혜택을 제공 설계 되었습니다. 유전자 편집 전략 지난 10 년간 등장, LV 수정 세포는 최고의 생체 외에서, 동물 모델, 그리고 환자1,</s…
Disclosures
The authors have nothing to disclose.
Acknowledgements
저자는이 원고, 그래픽 디자인, 짐 Woolace 그리고 베로니카 넬슨과 Devikha Chandrasekaran 프로토콜의 개발에 참여를 준비 하기 위한 헬렌 크로포드를 감사 합니다. 이 프로토콜의 개발 알레르기의 NIH 국립 연구소와 전염병 (R01 AI135953와 H.P.K. AI138329) 국가 심 혼, 폐, 및 혈액 연구소 (R01 HL136135, HL116217, P01 HL122173, 및 U19에서 교부 금에 의해 지원 되었다 H.P.K. HL129902), NIH P51 OD010425 뿐만 아니라, 일부 NIH/NCI 암 센터, 지원 그랜트 P30 CA015704를 통해. H.P.K.는 마 키 분자 의학 탐정 세포 및 유전자 치료에 대 한 암 연구와 프레드 허 치 부여의 자에 대 한 지원의 호세 카레라스/E. Donnall 토마스 부여 자의 취임 받는 사람으로 받은.
Materials
| Stemspam SFEM II ("HSPC") Media | StemCell | 09655 | |
| Hank's Balanced Salt Solution | Gibco | 14175095 | |
| Phosphate-Buffered Saline | Gibco | 14190-144 | |
| Penicillin/Streptomycin | Gibco | 15140-122 | |
| Dimethyl Sulfoxide | Sigma Aldrich | D2650-100 | |
| 100% Ethanol | Decon labs | M18027161M | |
| Cyclosporine | Sigma | 30024-25MG | |
| 500 mM EDTA | Invitrogen | 15575-038 | |
| Heat-Inactivated Fetal Bovine Serum | Sigma Aldrich | PS-0500-A | |
| CH-296/ RetroNectin (2.5 mL, 1 µg/µL) | TaKaRA | T100B | |
| Bovine Serum Albumin | Sigma | A7906-100g | |
| HEPES | Sigma | H9897 | |
| Rat anti-mouse IgM magnetic beads | Miltenyi Biotec | 130-047-301 | |
| Recombinant HumanStem Cell Factor (SCF) | Peprotech | 300-07 | |
| Recombinant Human Thrombopoietin (TPO) | Peprotech | 300-18 | |
| Recombinant Human FMS-like tyrosine kinase 3 (FLT-3) | Peprotech | 300-19 | |
| Protamine sulfate | Sigma | P-4505 | |
| 14 mL Polypropylene Round-Bottom Tube | Corning | 352059 | |
| Colony Gel 1402 | ReachBio | 1402 | |
| QuadroMACS Separators | Miltenyi Biotec | 130-090-976 | |
| MACS L25 Columns | Miltenyi biotec | 130-042-401 | |
| 10 mM PGE2 | Cayman Chemical | 14753-5mg | |
| TC-treated T-75 flasks | Bioexpress | T-3001-2 | |
| Non-TC-treated T-75 flasks | Thermo-Fisher | 13680-57 | |
| 20 ml syringes | BD Biosciences | 302830 | |
| 16.5 G needles | BD Precision | 305198 | |
| Syringe Tip Cap | BD Biosciences | 305819 | |
| QuickExtract DNA Solution | Epicentre | QE09050 | |
| 8-tube strip cap PCR Tubes | USA scientific | 1402-2708 | |
| 96-well Thermocycler | Thermo-Fisher | 4375786 | |
| Pre-Separation filters | Miltenyi Biotec | 130-041-407 | |
| Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS | fisher scientific | 352350 | |
| Ultracomp ebeads | eBioscience | 01-2222-42 | |
| MACSmix Tube Rotator | Miltenyi | 130-090-753 | |
| 3 mL Luer-Lock Syringes | Thermo-Fisher | 14823435 | |
| 35 mm x 10 mm cell culture dish | Corning | 430165 | |
| 60 mm x 15 mm cell culture dish | Corning | 430196 | |
| 150 mm x 25 mm cell culture dish | Corning | 430599 | |
| Non TC treated flasks | Falcon | 353133 | |
| Qiagen DNA extraction | Qiagen | 51104 | |
| PE Anti-Human CD90 (Thy1) Clone:5E10 | Biolegend | 328110 | |
| PE-CF594 Mouse Anti-Human CD34 Clone:563 | BD horizon | 562449 | |
| APC-H7 Mouse Anti-Human CD45RA Clone: 5H9 | BD Pharmingen | 561212 | |
| V450 Mouse Anti-NHP CD45 Clone:d058-1283 | BD Biosciences | 561291 | |
| Autologous Serum | Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Virus-Conditioned Media (VCM) | Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH) | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Anti-CD34 antibody, Clone 12.8 | Kiem Lab | N/A | Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010). |
| Lenti F primer: AGAGATGGGTGCGAGAGCGTCA | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Actin F primer: TCCTGTGGCACTCACGAAACT | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
| Actin R primer: GAAGCATTTGCGGTGGACGAT | Integrated DNA Technologies | N/A | Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016). |
References
- Radtke, S., et al. A distinct hematopoietic stem cell population for rapid multilineage engraftment in nonhuman primates. Science Translational Medicine. 9 (414), (2017).
- Majeti, R., Park, C. Y., Weissman, I. L. Identification of a hierarchy of multipotent hematopoietic progenitors in human cord blood. Cell Stem Cell. 1 (6), 635-645 (2007).
- Notta, F., et al. Isolation of single human hematopoietic stem cells capable of long-term multilineage engraftment. Science. 333 (6039), 218-221 (2011).
- Hoggatt, J., et al. Rapid mobilization reveals a highly engraftable hematopoietic stem cell. Cell. 172 (1-2), 191-204 (2018).
- Chandrasekaran, D., Nakamoto, B., Watts, K. L., Kiem, H. P., Papayannopoulou, T. Modeling promising nonmyeloablative conditioning regimens in nonhuman primates. Human Gene Therapy. 25 (12), 1013-1022 (2014).
- Humbert, O., Peterson, C. W., Norgaard, Z. K., Radtke, S., Kiem, H. P. A nonhuman primate transplantation model to evaluate hematopoietic stem cell gene editing strategies for beta-hemoglobinopathies. Molecular Therapy. Methods & Clinical Development. 8, 75-86 (2018).
- Peterson, C. W., et al. Differential impact of transplantation on peripheral and tissue-associated viral reservoirs: Implications for HIV gene therapy. PLoS Pathogens. 14 (4), e1006956-e1006956 (2018).
- Zhen, A., et al. Long-term persistence and function of hematopoietic stem cell-derived chimeric antigen receptor T cells in a nonhuman primate model of HIV/AIDS. PLoS Pathogens. 13 (12), e1006753 (2017).
- Moffett, H. F., et al. Hit-and-run programming of therapeutic cytoreagents using mRNA nanocarriers. Nature Communications. 8 (1), 389 (2017).
- Burtner, C. R., et al. Intravenous injection of a foamy virus vector to correct canine SCID-X1. Blood. 123 (23), 3578-3584 (2014).
- Evans, D. T., Silvestri, G. Nonhuman primate models in AIDS research. Current Opinion in HIV and AIDS. 8 (4), 255-261 (2013).
- Taraseviciute, A., et al. Chimeric antigen receptor T cell-mediated neurotoxicity in nonhuman primates. Cancer Discovery. 8 (6), 750-763 (2018).
- McGary, C. S., et al. CTLA-4(+)PD-1(-) memory CD4(+) T cells critically contribute to viral persistence in antiretroviral therapy-suppressed, SIV-infected rhesus macaques. Immunity. 47 (4), 776-788 (2017).
- Beard, B. C., Adair, J. E., Trobridge, G. D., Kiem, H. P. High-throughput genomic mapping of vector integration sites in gene therapy studies. Methods in Molecular Biology. 1185, 321-344 (2014).
- Zonari, E., et al. Efficient ex vivo engineering and expansion of highly purified human hematopoietic stem and progenitor cell populations for gene therapy. Stem Cell Reports. 8 (4), 977-990 (2017).
- Doulatov, S., et al. Revised map of the human progenitor hierarchy shows the origin of macrophages and dendritic cells in early lymphoid development. Nature Immunology. 11 (7), 585-593 (2010).
- Fares, I., et al. Cord blood expansion. Pyrimidoindole derivatives are agonists of human hematopoietic stem cell self-renewal. Science. 345 (6203), 1509-1512 (2014).
- Gori, J. L., et al. Endothelial cells promote expansion of long-term engrafting marrow hematopoietic stem and progenitor cells in primates. Stem Cells Translational Medicine. 6 (3), 864-876 (2017).
- Peterson, C. W., et al. Long-term multilineage engraftment of autologous genome-edited hematopoietic stem cells in nonhuman primates. Blood. 127 (20), 2416-2426 (2016).
- Peterson, C. W., et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Molecular Therapy. Methods & Clinical Development. 3, 16007 (2016).
- Thompson, A. A., et al. Gene therapy in patients with transfusion-dependent beta-thalassemia. The New England Journal of Medicine. 378 (16), 1479-1493 (2018).
- Eichler, F., et al. Hematopoietic stem-cell gene therapy for cerebral adrenoleukodystrophy. The New England Journal of Medicine. 377 (17), 1630-1638 (2017).
- Paul, B., et al. Efficient enrichment of gene-modified primary T cells via CCR5-targeted integration of mutant dihydrofolate reductase. Molecular Therapy. Methods & Clinical Development. 5 (9), 347-357 (2018).
- Levine, B. L., Miskin, J., Wonnacott, K. Global manufacturing of CAR T cell therapy. Molecular Therapy. Methods & Clinical Development. 4, 92-101 (2017).
- Masiuk, K. E., et al. Improving gene therapy efficiency through the enrichment of human hematopoietic stem cells. Molecular Therapy. 25 (9), 2163-2175 (2017).
- Trobridge, G. D., et al. Efficient transduction of pigtailed macaque hematopoietic repopulating cells with HIV-based lentiviral vectors. Blood. 111 (12), 5537-5543 (2008).
- Beard, B. C., et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354 (2010).
- Horn, P. A., et al. Efficient lentiviral gene transfer to canine repopulating cells using an overnight transduction protocol. Blood. 103 (10), 3710-3716 (2004).
- Adair, J. E., et al. Semi-automated closed system manufacturing of lentivirus gene-modified haematopoietic stem cells for gene therapy. Nature Communications. 7, 13173 (2016).
- Kutner, R. H., Zhang, X. Y., Reiser, J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nature Protocols. 4 (4), 495-505 (2009).
- Salmon, P., Trono, D. Production and titration of lentiviral vectors. Current Protocols in Human Genetics. 54 (1), (2007).
- Geraerts, M., Willems, S., Baekelandt, V., Debyser, Z., Gijsbers, R. Comparison of lentiviral vector titration methods. BMC Biotechnology. 6, 34 (2006).
- Kiem, H. P., et al. Improved gene transfer into baboon marrow repopulating cells using recombinant human fibronectin fragment CH-296 in combination with interleukin-6, stem cell factor, FLT-3 ligand, and megakaryocyte growth and development factor. Blood. 92 (6), 1878-1886 (1998).
- Morton, W. R., Knitter, G. H., Smith, P. M., Susor, T. G., Schmitt, K. Alternatives to chronic restraint of nonhuman primates. Journal of the American Veterinary Medical Association. 191 (10), 1282-1286 (1987).
- Noser, J. A., et al. Cyclosporine increases human immunodeficiency virus type 1 vector transduction of primary mouse cells. Journal of Virology. 80 (15), 7769-7774 (2006).
- Uchida, N., Hsieh, M. M., Washington, K. N., Tisdale, J. F. Efficient transduction of human hematopoietic repopulating cells with a chimeric HIV1-based vector including SIV capsid. Experimental Hematology. 41 (9), 779-788 (2013).
- Cornetta, K., Anderson, W. F. Protamine sulfate as an effective alternative to polybrene in retroviral-mediated gene-transfer: implications for human gene therapy. Journal of Virological Methods. 23 (2), 187-194 (1989).
- Goerner, M., et al. The use of granulocyte colony-stimulating factor during retroviral transduction on fibronectin fragment CH-296 enhances gene transfer into hematopoietic repopulating cells in dogs. Blood. 94 (7), 2287-2292 (1999).
- Dao, M. A., Hashino, K., Kato, I., Nolta, J. A. Adhesion to fibronectin maintains regenerative capacity during ex vivo culture and transduction of human hematopoietic stem and progenitor cells. Blood. 92 (12), 4612-4621 (1998).
- North, T. E., et al. Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 447 (7147), 1007-1011 (2007).
- Goessling, W., et al. Prostaglandin E2 enhances human cord blood stem cell xenotransplants and shows long-term safety in preclinical nonhuman primate transplant models. Cell Stem Cell. 8 (4), 445-458 (2011).
- Booth, C., Gaspar, H. B., Thrasher, A. J. Treating immunodeficiency through HSC gene therapy. Trends in Molecular Medicine. 22 (4), 317-327 (2016).
- Humbert, O., et al. Rapid immune reconstitution of SCID-X1 canines after G-CSF/AMD3100 mobilization and in vivo gene therapy. Blood Advances. 2 (9), 987-999 (2018).
