Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

Summary

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

Abstract

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 10⁶ to 1 x 10⁷ plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

Introduction

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide¹. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly². There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development^3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable efforts. The quantification of RSV multiplication in vitro is generally based on laborious, time-consuming, and expensive methods, which consist mostly in the analysis of the cytopathic effect by microscopy, immunostaining, plaque reduction assays, quantitative reverse transcriptase (qRT)-polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay tests. Viruses with modified genomes and expressing reporter genes, such as those coding for the GFP, are more suitable for such screenings. Coupled to the use of automated plate readers, reporter gene-carrying recombinant viruses can make these assays more suitable for standardization and high-throughput purposes.

RSV is an enveloped, nonsegmented negative-sense RNA virus that belongs to the Orthopneumovirus genus of the Pneumoviridae family, order Mononegavirales⁵. The RSV genome is a single-strand, negative-sense RNA of about 15 kb, which contains a noncoding region at the 3' and 5' extremities called Leader and Trailer and 10 transcriptional units encoding 11 proteins. The genes are ordered as follows: 3'-NS1, NS2, N, P, M, SH, G, F, M2 (encoding for M2-1 and M2-2 proteins) and L-5'. The genomic RNA is tightly packaged by the nucleoprotein N. Using the encapsidated genomic RNA as a template, viral RNA-dependent RNA polymerase (RdRp) will ensure transcription and replication of the viral RNA. Viral RdRp is composed of the large protein L which carries the nucleotide polymerase activity per se, its mandatory cofactor the phosphoprotein P and the M2-1 protein which functions as a viral transcription factor⁶. In infected cells, RSV induces the formation of cytoplasmic inclusions called inclusion bodies (IBs). Morphologically similar cytoplasmic inclusions have been observed for several Mononegavirales^7,8,9,10. Recent studies on rabies virus, vesicular stomatitis virus (VSV), Ebola virus, and RSV showed that viral RNA synthesis occurs in IBs, which can thus be regarded as viral factories^8,9,11,12. The virus factories concentrate the RNA and viral proteins required for viral RNA synthesis and also contain cellular proteins^{13,14,15,16,17}. IBs exhibit a functional subcompartment called IB-associated granules (IBAGs), which concentrate the newly synthetized nascent viral mRNA together with the M2-1 protein. The genomic RNA and the L, P, and N are not detected in IBAGs. IBAGs are small dynamic spherical structures inside IBs that exhibit the properties of liquid organelles¹². Despite the central role of IBs in viral multiplication, very little is known about the nature, internal structure, formation, and operation of these viral factories.

The expression of the genome of a poliovirus from a cDNA enabled the production of the first infectious viral clone in 1981¹⁸. For single-stranded negative RNA viruses, it was not until 1994 that the production of a first rabies virus following transfection of plasmids into cells¹⁹ took place. The first plasmid-based reverse genetic system for RSV was published in 1995²⁰. Reverse genetics have led to major advances in the field of virology. The possibility of introducing specific modifications into the viral genome has provided critical insights into the replication and pathogenesis of RNA viruses. This technology has also greatly facilitated the development of vaccines by allowing specific attenuation through targeted series of modifications. Genome modifications allowing a rapid quantification of viral multiplication greatly improved the antiviral screening and study of their mode of action.

Although previously described, obtaining genetically modified RSVs remains delicate. Here, we detail a protocol to create two types of recombinant HRSV, respectively expressing RSV-GFP or RSV-M2-1-GFP. In this protocol, we describe the transfection conditions needed to rescue the new recombinant viruses, as well as their amplification to obtain viral stocks with high titer, suitable for reproducible experimentations. The construction of the reverse genetics' vectors per se is not described here. We do describe methods for the optimal harvesting and freezing of viral stocks. The most accurate method to quantify viral infectious particles remains plaque assay. Cells are infected with serial dilutions of the analyzed suspension and incubated with an overlay that prohibits the diffusion of free viral particles in the supernatant. In such conditions, the virus will only infect contiguous cells forming a "plaque" for each initial infectious particle. In the conventional RSV titration assay, plaques are revealed by immunostaining and counted under microscopic observation. This method is expensive and time-consuming. Here we described a very simple protocol for an RSV plaque assay using microcrystalline cellulose overlay that enables the formation of plaques visible to the naked eye. We show how RSV-GFP can be used to measure RSV replication and, thus, to quantify the impact of antivirals. Combining reverse genetics and live imaging technology, we demonstrate how RSV-M2-1-GFP allows scientists to visualize M2-1 in live cells and to follow the dynamics of intracellular viral structures, such as IBs.

Protocol

1. Material Preparation Purchase cell media (reduced serum media, minimum essential media [MEM], 10x MEM, and Dulbecco’s modified Eagle’s medium [DMEM]), transfection reagent, and microcrystalline cellulose (see Table of Materials). Obtain the following vectors for reverse genetics: the genomic vector(s) and the expression vectors encoding the N protein and the polymerase complex proteins. The genomic vectors contain the full cDNA genome of RSV-GFP (p-RSV-GFP) and of RSV…

Representative Results

In this work, we described a detailed protocol to produce recombinant RSV viruses expressing a fluorescent protein (Figure 2). In pRSV-GFP, the GFP gene was introduced between the P and M genes, as described for the Cherry gene in previously published work21. In the pRSV-M2-1-GFP, the M2 gene was left untouched and an additional gene coding for M2-1-GFP was inserted between SH and G genes12. The first step, corr…

Discussion

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag¹². RSV rescue is challenging and requires practice. The trans…

Materials

35mm µ dish for live cell imaging	Ibidi	81156
A549	ATCC	ATCC CCL-185
Avicel RC-591	FMC BioPolymer	Avicel RC-591	Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.
BSRT7/5		not commercially available	See ref 22. Buchholz et al, 1999
Crystal violet solution	Sigma	HT90132
Fluorescence microscope for observations	Olympus	IX73 Olympus microscope
Fluorescence microscope for videomicroscopy	Olympus	ScanR Olympus microscope
HEp-2	ATCC	ATCC CCL-23
HEPES ≥99.5%	Sigma	H3375
L-Glutamine (200 mM)	ThermoFisher Scientific	25030024
LIPOFECTAMINE 2000 REAGENT	ThermoFisher Scientific	11668019	Protocol in step 2.3. is optimized for this reagent.
MEM (10X), no glutamine	ThermoFisher Scientific	11430030
MEM, GlutaMAX Supplement	ThermoFisher Scientific	41090-028
MgSO4 ReagentPlus, ≥99.5%	Sigma	M7506
Opti-MEM I Reduced Serum Medium	ThermoFisher Scientific	51985-026
Paraformaldehyde Aqueous Solution, 32%, EM Grade	Electron Microscopy Sciences	15714
Penicillin-Streptomycin (10,000 U/mL)	ThermoFisher Scientific	15140122
Plasmids		not commercially available	see ref 21. Rameix-Welti et al, 2014
See Saw Rocker	VWR	444-0341
Si RNA GAPDH	Dharmacon	ON-TARGETplus siRNA D-001810-10-05	SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.
Si RNA IMPDH2	Dharmacon	ON-TARGETplus siRNA IMPDH2 Pool- Human L-004330-00-0005	SMARTpool of 4 individual siRNAs designed by Dharmacon. Individual references and sequences J-004330-06: GGAAAGUUGCCCAUUGUAA; J-004330-07: GCACGGCGCUUUGGUGUUC; J-004330-08: AAGGGUCAAUCCACAAAUU; J-004330-09: GGUAUGGGUUCUCUCGAUG;
Si RNA RSV N	Dharmacon	ON-TARGETplus custom siRNA	UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA
SiRNA NT	Dharmacon	ON-TARGETplus Non-targeting Pool
SiRNA transfection reagent	Dharmacon	DharmaFECT 1 Ref: T-2001-03	Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.
Sodium Bicarbonate 7.5% solution	ThermoFisher Scientific	25080094
Spectrofluorometer	Tecan	Tecan infinite M200PRO