등온 적정 열량계를 사용하여 DNA 압타머와 테트라사이클린의 열역학적 및 동역학적 연관성 결정
Summary
본 프로토콜은 샘플 준비, 실행 표준 및 샘플을 포함하여 DNA 압타머와 테트라사이클린 간의 결합의 연관성 및 해리 역학을 분석하고 결과 데이터를 해석하기 위한 등온 적정 열량측정법(ITC)의 사용을 설명합니다.
Abstract
압타머와 그 표적 사이의 결합 친화도와 거동을 결정하는 것은 적용을 위해 압타머를 선택하고 사용하는 가장 중요한 단계입니다. 압타머와 저분자 사이의 급격한 차이로 인해 과학자들은 결합 특성을 특성화하는 데 많은 노력을 기울일 필요가 있습니다. 등온 적정 열량측정법(ITC)은 이러한 목적을 위한 강력한 접근 방식입니다. ITC는 분리 상수(Kd)를 결정하는 것 이상으로 용액 단계에서 두 분자 간의 상호 작용에 대한 엔탈피 변화 및 결합 화학량론을 제공할 수 있습니다. 이 접근법은 표지가 없는 분자를 사용하여 연속 적정을 수행하고 각 적정에 의해 생성된 결합 이벤트에 따라 시간이 지남에 따라 방출되는 열을 기록하므로 공정은 거대분자와 작은 표적 간의 결합을 민감하게 측정할 수 있습니다. 본 명세서에서는 선택된 압타머와 소형 표적인 테트라사이클린의 ITC 측정의 단계별 절차를 소개합니다. 이 예는 기술의 다양성과 다른 응용 분야에 대한 잠재력을 입증합니다.
Introduction
압타머는 원하는 표적 1,2에 대한 높은 결합 친화도 및 특이성을 갖는 진화 과정을 통해 선택된 ssDNA 또는 RNA 단편으로, 고급 인식 요소 또는 화학 항체 3,4,5로 작용할 수 있습니다. 따라서, 표적에 대한 압타머의 결합 친화도 및 특이성은 압타머의 선택 및 적용에 결정적인 역할을 하며, 등온 적정 열량측정법(ITC)이 이러한 특성화 목적으로 널리 사용되어 왔다. 압타머의 친화도를 측정하기 위해 ITC, 표면 플라즈몬 공명(SPR), 비색 적정, 마이크로 스케일 열영동(MST) 및 바이오층 간섭계(BLI)를 포함한 많은 접근법이 사용되었습니다. 그 중 ITC는 용액 단계에서 두 분자의 열역학적 및 운동 적 결합을 결정하는 최신 기술 중 하나입니다. 이 접근법은 표지가없는 분자를 사용하여 연속 적정을 수행하고 각 적정 6,7에 의해 생성 된 결합 이벤트에 따라 시간이 지남에 따라 방출 된 열을 기록합니다. 다른 방법과 달리 ITC는 결합 친화도, 여러 결합 부위, 열역학적 및 동역학적 연관성을 제공할 수 있습니다(그림 1A). 이러한 초기 매개 변수에서 Gibbs 자유 에너지 변화와 엔트로피 변화는 다음 관계를 사용하여 결정됩니다.
ΔG = ΔH-TΔS
이는 ITC가 결합 메커니즘을 설명하기 위해 분자 상호 작용의 완전한 열역학적 프로파일을 제공한다는 것을 의미합니다(그림 1B). 압타머를 사용한 소분자의 결합 친화도를 결정하는 것은 압타머와 표적 사이의 크기가 크게 다르기 때문에 어렵습니다. 한편, ITC는 분자를 표지하고 고정화하지 않고도 민감한 측정을 제공할 수 있으며, 이는 측정 중에 압타머와 표적의 자연 구조를 유지하는 수단을 제공합니다. 언급된 특성을 통해 ITC는 압타머와 소형 표적 간의 결합 특성화를 위한 표준 방법으로 사용할 수 있습니다.
Gu 그룹에 의한 선택 후, 이 압타머는 전기화학적 압타머 기반 바이오센서, 경쟁력 있는 효소 결합 압타머 분석법 및 테트라사이클린 8,9,10의 고처리량 검출을 달성할 수 있는 마이크로타이터 플레이트를 포함한 다양한 플랫폼과 통합되었습니다. 그러나, 그 결합 특성은 적절한 플랫폼8을 선택하기에 충분히 잘 밝혀지지 않았다. ITC를 사용하여 압타머와 테트라 사이클린의 결합을 특성화 할 가치가 있습니다.
Protocol
Representative Results
Discussion
여기에 제시된 방법은 TA Instruments의 지시에 따라 수정되었으며 당사 센터에서 선택된 많은 압타머 및 표적의 결합 친화도 및 열역학을 결정하기에 충분합니다. 이 절차의 중요한 단계에는 리간드와 일치하는 표적을 갖도록 버퍼를 교환하고, 적절한 매개 변수로 샘플을 실행하고, 데이터를 분석하기 위한 적절한 결합 피팅 모델을 찾는 것이 포함됩니다. 열 방출을 지속적으로 기록하려면 버퍼의 ?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
이 연구는 Aptagen LLC의 연구 개발 자금으로 지원되었습니다.
Materials
| 5'-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG C TTGGGTTGGTCCCACTGCGCG TGGATCCGAGCTCCAC GTG-3' |
Integrated DNA Technologies, Inc | The sequence is adopted from Gu's research, which has not identified Kd using ITC (refer references 8 and 9) | |
| Affinity ITC Auto Low Volume (190 µL) System Complete–Gold Cells | TA Instruments | 61000.901 | Isothermal titration calorimetry system |
| CaCl2 | Avantor (VWR) | E506-100ML | Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile |
| Centrifuge | Eppendorf | 5417R | The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g. |
| Complete Degassing Station (110/230V) | TA Instruments | 6326 | This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation. |
| EDTA | TekNova | E0375 | EDTA 500 mM, pH 7.5 |
| NanoDrop One Microvolume UV-Vis Spectrophotometer | ThermoFisher | ND-ONE-W | UV-Vis Spectrophotometer |
| Nanosep, Nanosep MF and NAB Centrifugal Devices | Pall Laboratory | OD030C34 | 3 kDa molecular weight cutoff concentrator |
| PBS pH 7.4 | IBI Scientific | IB70165 | Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 µm filter. Autoclaved at 121 °C for greater than 20 min. |
| Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes | labForce (a Thomas Scientific Brand) | 1149K01 | |
| Tetracycline, Hydrochoride | EMD Millipore Corperation | CAS64-75-5 |
References
- Ellington, A. D., Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature. 346 (6287), 818-822 (1990).
- Tuerk, C., Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 249 (4968), 505-510 (1990).
- Kim, S. H., Thoa, T. T. T., Gu, M. B. Aptasensors for environmental monitoring of contaminants in water and soil. Current Opinion in Environmental Science & Health. 10, 9-21 (2019).
- Dunn, M. R., Jimenez, R. M., Chaput, J. C. Analysis of aptamer discovery and technology. Nature Reviews Chemistry. 1, 0076 (2017).
- Stoltenburg, R., Reinemann, C., Strehlitz, B. SELEX–A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomolecular Engineering. 24 (4), 381-403 (2007).
- Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics. Frontiers in Molecular Biosciences. 7, 583826 (2020).
- Velazquez-Campoy, A., Freire, E. Isothermal titration calorimetry to determine association constants for high-affinity ligands. Nature Protocols. 1 (1), 186-191 (2006).
- Niazi, J. H., Lee, S. J., Gu, M. B. Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).
- Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. Electrochemical aptasensor for tetracycline detection. Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).
- Wang, S., et al. Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey. Biosensors & Bioelectronics. 57, 192-198 (2014).
- Kim, Y. S., et al. A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline. Biosensors & Bioelectronics. 26 (4), 1644-1649 (2010).
- Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. Regulation of photosensitisation processes by an RNA aptamer. Scientific Reports. 7, 43272 (2017).
- Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. Solution structure and thermodynamics of 2′,5′ RNA intercalation. Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).
- Sigurskjold, B. W. Exact analysis of competition ligand binding by displacement isothermal titration calorimetry. Analytical Biochemistry. 277 (2), 260-266 (2000).
- Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. Salt-mediated two-site ligand binding by the cocaine-binding aptamer. Nucleic Acids Research. 45 (3), 1041-1048 (2017).
- Turnbull, W. B., Daranas, A. H. On the value of c: Can low affinity systems be studied by isothermal titration calorimetry. Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).
- Van Ness, J., Van Ness, L. K., Galas, D. J. Isothermal reactions for the amplification of oligonucleotides. Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).
