TChIP-Seq: Hücre türüne özgü Epigenome profil oluşturma
Summary
Biz tandem kromatin için adım adım bir protokol tarif immunoprecipitation sıralama (tChIP-Seq) hücre türüne özgü genom çapında histon değişiklik çözümleme sağlar.
Abstract
Epigenetik yönetmelik gen ifadesinde merkezi rol oynar. Histon değişiklik 1960’larda keşfetti, fizyolojik ve patolojik fonksiyonları kapsamlı bir şekilde incelenmiştir. Gerçekten de, yeni nesil derin sıralama ve kromatin immunoprecipitation (ChIP) belirli histon değişiklik antikorlar ile bizim görünümü epigenetik Yönetmeliğin genom arasında devrim yarattı. Diğer taraftan, dokular genellikle farklı hücre türleri oluşur ve onların karmaşık karışımı belirli bir hücreye epigenome soruşturma için analitik sorunlar teşkil etmektedir. Biz son zamanlarda kromatin seçici arıtma tagged çekirdek histon proteinleri hücre tarafından dayanmaktadır tandem kromatin immunoprecipitation sıralama (tChIP-Seq), hücre türüne özgü kromatin devlet bir genom geniş şekilde yönelik olarak geliştirilen faiz, ChIP-Seq. tarafından takip türleri Bu iletişim kuralının amacı tChIP-devamı en iyi uygulamalar giriştir Bu teknik için çeşitli histon modifikasyonları ve model organizmalar doku özel epigenome soruşturma çok yönlü bir araç sağlar.
Introduction
Hayvan dokuları farklı hücre türleri oluşur. Gen düzenlemesi her hücrede hücre türü tanımlar. Kromatin değişiklikler – DNA metilasyonu ve histon değişikliği – gen ekspresyonu hücre tipi özgüllük altında yatan. Bu nedenle, her hücre tipi epigenetik yönetmelikle ölçülmesi istenen ancak teknik bir mücadele vardı.
Tandem kromatin immunoprecipitation sıralama (tChIP-Seq) belirli bir hücreye epigenetik araştırmak için son zamanlarda geliştirilen (resim 1)1yapıldı. TChIP içinde bir hücre türüne özgü organizatörü epitope öğesini çekirdek histon protein H2B ifade edilir. Malzeme çeşitli hücre türlerinin bir karışımını başlar, ancak bu özellik chromatins ilgi, hücrelerden yalıtım sağlar. Aşağıdaki ChIP-Seq — kromatin arınma yolu ile bir değişikliğin histon işareti ve yeni nesil derin sıralama, izole DNA — bir genom geniş şekilde hedeflenen hücre tipi epigenetik durumunu izleyebilirsiniz.
Bu tekniği kullanarak, biz son zamanlarda araştırdık histon H3 protein lizin 4 (H3K4me3), nöron özel trimethylation işaretleri. Bu çalışmada, geliştirdiğimiz bir çakma fare hangi C-ölümcül içinde bayrak öğesini H2B protein Cre-aracılı rekombinasyon (Rosa26CAG floxed-pA H2B-bayrak) ifade edildi. Cre-endoplasmic retikulum (ER) gen CamK2a Düzenleyicinin kontrolü altında sahip bir fare ile geçiş tarafından elde edilen fare çizgi üzerine tamoxifen enjeksiyon (Camk2aH2B-bayrak)1aktif nöron H2B-bayrak indüklenen. Kurulan fare çizgi beyinden başlayarak, biz tChIP-Seq anti-H3K4me3 antikor ile gerçekleştirilen. Bu yana H3K4me3 işaretleri çoğunlukla organizatörü bölgelere karşılık, özellikle nöronlar1‘ ifade mRNA’ların yüzlerce keşfetmek olabilir.
Burada, doku diseksiyon adımlarına Kütüphane inşaat ()Şekil 1)kapsayan bir tipik tChIP-Seq yöntemi açıklanmaktadır. Bu iletişim kuralı son tChIP-Seq performansını ve diğer hücre tipleri ve histon değişiklikler bu yöntemin uygulama gelecek için bizim en iyi uygulamaları paylaşmak için hedeftir.
Protocol
Representative Results
Discussion
Bizim iletişim kuralı H2B bayrak öğesini ifade tamoxifen enjeksiyonu ile indüklenen olduğu fare beynin nöronlar için optimize edildi. H2B ifade, başlangıç doku malzeme ve doku miktarı için kullanılan Rehberleri başarılı tChIP-devamı çok önemli parametreleridir Böylece, bu faktörlerin optimizasyonu ilgi her hücre türü için düşünülmelidir.
Bu protokol için kullanılan yordamlar arasında önemli bir adım 100-500 bp5kromatin uzunluğunu elde…
Declarações
The authors have nothing to disclose.
Acknowledgements
Iwasaki laboratuvar şekilde alt alta yazılmalıdır eleştirel okuma için tüm üyeleri teşekkür ediyoruz. Bu eser kısmen yenilikçi alanları (#26113005); S.N. ve JP17H05679 sı için bilimsel araştırma için bir Grant-in-Aid tarafından desteklenmiştir Genç bilim adamları için bir Grant-in-Aid (A) sı için (JP17H04998) Milli Eğitim Bakanlığı, bilim, spor ve kültür Japonya (MEXT); ve Pioneering “Hücresel evrim” ve tüm RIKEN proje “Hastalığı ve Epigenome” RIKEN üzerinden (için S.N. ve sı) projeleri.
Materials
| Protein LoBind tube, 2 mL | Eppendorf | No. 0030108132 | For cell lysis |
| Protein LoBind tube, 1.5 mL | Eppendorf | No. 0030108116 | For ChIP and library preparation |
| DNA LoBind tube, 1.5 mL | Eppendorf | No. 0030108051 | For ChIP and library preparation |
| 8-strip PCR tube | BIO-BIK | 3247-00 | For ChIP and library preparation |
| SK Mill | TOKKEN | SK-200 | Handy cryogenic grinder to make cell powder for fixation |
| Metal bullet | TOKKEN | SK-100-DLC10 | Accessory of SK Mill |
| 2 mL stainless steel tube | TOKKEN | TK-AM5-SUS | An option for cell lysis |
| 2 mL stainless steel tube holder | TOKKEN | SK-100-TL | An option for cell lysis |
| 16% formaldehyde (w/v), methanol-free | Pierce | 28906 | To fix cells. Prepare 1% solution before use. |
| Glycine | Nacalai Tesque | 17109-35 | Prepare 2.5 M stock |
| D-PBS (-)(1x) | Nacalai Tesque | 14249-24 | For washing lysate and purified DNA |
| HEPES | Nacalai Tesque | 02443-05 | For Lysis buffer 1. Prepare 1 M, pH 7.5 stock. |
| 5 M NaCl, molecular biology grade | Nacalai Tesque | 06900-14 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| 0.5 M EDTA, molecular biology grade | Wako Pure Chemical Industries, Ltd. | 311-90075 | For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer |
| Glycerol | Wako Pure Chemical Industries, Ltd. | 072-04945 | For lysis buffer 1 |
| NP-40 | Nacalai Tesque | 25223-75 | For lysis buffer 1 |
| Triton X-100, molecular biology grade | Nacalai Tesque | 12967-32 | For Lysis buffer 1 |
| Tris | Nacalai Tesque | 35406-91 | For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock. |
| 0.1 M EGTA pH neutral | Nacalai Tesque | 08947-35 | For Lysis Buffer 2 |
| Protease inhibitor cocktail (100x) | Nacalai Tesque | 25955-24 | To block degradation of protein |
| RIPA buffer | Thermo Fisher Scientific | 89900 | For cell lysis and washing |
| milliTUBE 1 mL AFA Fiber | Covaris | 520130 | Sonicator tube. Accessory of Focused-ultrasonicator |
| Focused-ultrasonicator | Covaris | S220 or E220 | To digest DNA into adequate size for ChIP-Seq |
| UltraPure 10% SDS | Thermo Fisher Scientific | 15553-027 | For ChIP Elution Buffer |
| RNase A | Nacalai Tesque | 30141-14 | To purify DNA from lysate |
| Proteinase K, recombinant, PCR Grade | Sigma-Aldrich | 3115887001 | To purify DNA from lysate |
| Ethanol | Wako Pure Chemical Industries, Ltd. | 054-07225 | Make 70% solution |
| Monoclonal anti-FLAG M2 antibody produced in mouse | Sigma-Aldrich | F1804 | To purify chromatin expressed in cells of interest |
| Dynabead M-280 Sheep Anti-Mouse IgG | Thermo Fisher Scientific | 11201D | This can be used for anti-FLAG IP and anti-H3K4me3 IP |
| Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody | Wako Pure Chemical Industries, Ltd. | 301-34811 | Any other antibody that works for ChIP analysis will work |
| 10x Blocking Reagent | Sigma-Aldrich | 11096176001 | For blocking during affinity purification |
| Denhardt’s solution | Nacalai Tesque | 10727-74 | For blocking during affinity purification |
| Glycogen (5 mg/ml) | Thermo Fisher Scientific | AM9510 | To purify DNA from lysate |
| Qubit 2.0 Fluorometer | Thermo Fisher Scientific | Q32866 | For quantification of isolated DNA |
| Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Q32851 | For quantification of isolated DNA |
| 0.5 mL tube | Axygen | 10011-830 | For quantification by Qubit |
| Phenol/chloroform/isoamyl alcohol (25:24:1) | Nacalai Tesque | 25970-56 | To purify DNA from lysate |
| AMPure XP beads | Beckman Coulter | A63881 | SPRI magnetic beads for library preparation |
| Metal ice rack | Funakoshi | IR-1 | To keep the cell lysate frozen |
| Sample Cooler | New England Biolabs | T7771S | Helps fix cells with minimal damage |
| 2100 Bioanalyzer | Agilent Technologies | G2939BA | To check the quality of isolated DNA fragments. Another fragment analyzer can be used. |
| Bioanalyzer 2100 Expert Software | Agilent Technologies | G2946CA | Supplied with the Bioanalyzer |
| High Sensitivity DNA Kit | Agilent Technologies | 5067-4626 | To check the quality of the isolated DNA fragments |
| KAPA LTP Library Preparation Kit | Roche | 07961898001 | Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution |
| NEXTflex DNA Barcodes | BIOO Scientific | NOVA-514101 | Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix. |
| KAPA Real-Time Library Amplification Kit | Roche | 07959028001 | Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards |
| 2x KAPA HiFi HotStart ReadyMix | Roche | KM2602 | For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit |
| Buffer EB | Qiagen | 19086 | 10 mM Tris-Cl, pH 8.5 for elution of DNA |
| 386-well qPCR plate | Thermo Fisher Scientific | 4309849 | For real-time PCR |
| QuantStudio 7 Flex Real-Time PCR System | Thermo Fisher Scientific | 4485701 | To quantify DNA |
| MicroAmp Optical Adhesive Film | Thermo Fisher Scientific | 4311971 | For real-time PCR |
| MicroAmp Clear Adhesive Film | Thermo Fisher Scientific | 4306311 | For plate sealing |
| End-repair master mix | Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O | ||
| A-taling master mix | Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O | ||
| Ligation buffer mix | Combine 2 µL of KAPA ligation buffer and 6 µL of H2O | ||
| Real-time PCR master mix | Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O | ||
| PCR master mix | Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O | ||
| Integrative Genomics Viewer | Broad Institute | IGV_2.3.88 | Genome browser to visualize sequencing data |
| DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ | Eurofins Genomics | A primer to amplify the promoter region of GAPDH | |
| SYBR Premix Ex Taq | Takara | RR420L | To quantify the DNA corresponding to the GADPH promoter region |
| Thermal Cycler Dice | Takara | TP870 | To quantify the DNA corresponding to the GADPH promoter region |
Referências
- Mito, M., et al. Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing. Scientific Reports. 8 (1), 1143 (2018).
- Kadota, M., et al. CTCF binding landscape in jawless fish with reference to Hox cluster evolution. Scientific Reports. 7 (1), 4957 (2017).
- Jung, Y. L., et al. Impact of sequencing depth in ChIP-seq experiments. Nucleic Acids Research. 42 (9), (2014).
- Becker, P. B., Workman, J. L. Nucleosome remodeling and epigenetics. Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).
- Kidder, B. L., Zhao, K. Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells. Methods in Molecular Biology. , 3-20 (2014).
- Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
- Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nature Methods. 12 (10), 963-965 (2015).
- Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34 (36), 11929-11947 (2014).
- Hornstein, N., et al. Ligation-free ribosome profiling of cell type-specific translation in the brain. Genome Biology. 17 (1), 149 (2016).
- Zhao, Y., Garcia, B. A. Comprehensive catalog of currently documented histone modifications. Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).
- Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. Formaldehyde crosslinking: a tool for the study of chromatin complexes. The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).
