عزل وإكثار بريون البروتين التعبير خلال تمايز الخلايا العصبية من الخلايا الجذعية البشرية لب الأسنان
Summary
نقدم هنا بروتوكولا لعزل “الخلايا الجذعية لب الأسنان” البشرية والدعوة من أجل تقييم التعبير بريون البروتين أثناء عملية تمايز الخلايا العصبية.
Abstract
قضايا الأخلاقيات البيولوجية المتصلة بالتلاعب بالخلايا الجذعية الجنينية أعاقت التقدم في مجال البحوث الطبية. ولهذا السبب، من المهم جداً للحصول على الخلايا الجذعية البالغة من أنسجة مختلفة مثل الدهنية والحبل السري والنخاع العظمى والدم. بين المصادر الممكنة، لب الأسنان تتسم بأهمية خاصة لأنه من السهل الحصول عليها فيما يتعلق باعتبارات أخلاقيات علم الأحياء. والواقع أن الخلايا الجذعية لب الأسنان البشرية (هدبسكس) هي نوع من الخلايا الجذعية البالغة قادرة على التمييز في الخلايا العصبية مثل ويمكن الحصول عليها من المولى الثالث للمرضى الأصحاء (الفئة العمرية 13-19). على وجه الخصوص، لب الأسنان تم إزالتها مع حفارة مقطعة شرائح صغيرة وتعامل مع كولاجيناز الرابع ومثقف في قارورة. للحث على التفريق بين الخلايا العصبية، قد حفزت هدبسكس مع لو/بفجف لمدة أسبوعين. سابقا، قد أثبتنا أنه أثناء عملية التمايز محتوى الخلوية بريون البروتين (PrPج) في هدبسكس زيادة. وأظهر تحليل سيتوفلوريميتريك تعبير مبكر عن الحزب الثوريج التي ازدادت بعد عملية تمايز الخلايا العصبية. الاجتثاث من الحزب الثوريج قبل siRNA PrP حالت دون تمايز الخلايا العصبية الناجمة عن لو/بفجف. في هذه الورقة، توضح لنا أن علينا تعزيز العزل والفصل و في المختبر أساليب زراعة هدبسكس مع عدة إجراءات سهلة، كانت أكثر كفاءة الخلية استنساخ التوسع على نطاق واسع والتي تم الحصول عليها للخلايا الجذعية الوسيطة (MSCs) وقد لوحظ. ونحن أيضا إظهار كيف هدبسكس، التي تم الحصول عليها بطرق مفصلة في البروتوكول، ونموذج تجريبي ممتازة لدراسة عملية تمايز الخلايا العصبية MSCs والعمليات الجزيئية والخلوية اللاحقة.
Introduction
وكانت الخلايا الجذعية الوسيطة معزولة من أنسجة عدة، بما فيها نخاع العظام ودم الحبل السري ولب الأسنان البشرية، والأنسجة الدهنية والدم1،2،3،،من45 , 6-كما أفاد العديد من المؤلفين، هدبسكس إظهار البلاستيك التقيد، مورفولوجيا تنتجها الخلايا الليفية مثل نموذجي. وهذه تمثل عدد سكان العالية غير متجانسة مع الحيوانات المستنسخة مميزة والاختلافات في القدرات التكاثري والتفريق7،8. هدبسكس التعبير عن علامات محددة للخلايا الجذعية الوسيطة (أي CD44، CD90، CD73، CD105، قامت-1)، وهي سلبية لبعض العلامات المكونة للدم (مثل CD14 و CD19) وهي قادرة على التمايز في المختبر مولتيلينيجي9، 10،11.
وقد أظهرت العديد من المؤلفين أن هذه الخلايا غير قادرة على التمييز في الخلايا العصبية مثل استخدام البروتوكولات المختلفة، التي تشمل إضافة ستموت، بفجف، لو في تركيبة مع محدد وسائط الإعلام والملاحق7،12. أيضا، تشارك العديد من البروتينات أثناء عملية تمايز الخلايا العصبية، ومن بين هذه، تظهر عدة ورقات دور ذات الصلة والتعبير كبيرة من بروتين بريون الخلوية (PrPج)، سواء في الخلايا الجذعية الجنينية والبالغة13، 14-يمثل الحزب الثوريج جزيء بليوتروبيك قادرة على أداء وظائف مختلفة داخل الخلايا كالنحاس الأيض، المبرمج، والتشديد على المقاومة للأكسدة15،،من1617 , 18 , 19 , 20 , 21 , 22.
لدينا ورقة السابقة23، نحن التحقيق في دور الحزب الثوريج في عملية تمايز الخلايا العصبية هدبسكس. وفي الواقع، هدبسكس إكسبريس بريكوسيوسلي PrPج ، وبعد التفريق بين الخلايا العصبية، كان من الممكن نلاحظ زيادة إضافية. مؤلفين آخرين الافتراض بدور محتمل للحزب الثوريج في عمليات تمييز الخلايا العصبية من الخلايا الجذعية. وفي الواقع، محركات PrPج التفريق بين الخلايا الجذعية الجنينية البشرية في الخلايا العصبية، وأوليجوديندروسيتيس، وأستروسيتيس24. وكان الغرض من هذه الدراسة التأكيد على المنهجية للحصول على الخلايا الجذعية من لب الأسنان وعملية التمايز ودور الحزب الثوريج خلال تمايز الخلايا العصبية.
Protocol
Representative Results
Discussion
في هذا العمل، وركزنا على منهجية للعزل والتفريق بين الخلايا العصبية هدبسكس؛ وعلاوة على ذلك، يمكننا تقييم دور الحزب الثوريج في هذه العملية. هناك عدة طرق لعزل والتفريق بين هدبسكس في الخلايا مثل الخلايا العصبية والخطوات الحاسمة خلال العملية. هدبسكس قادرين على التفريق في الأنساب عدة مث?…
Declarações
The authors have nothing to disclose.
Acknowledgements
هذا العمل أيده “مؤسسة بروني” ومحور جامعة رييتي “سابينا الجامعي” إلى ماتي فينتشنزو.
الشكل 5 (أ، ب) طبع بإذن الناشر تايلور وفرانسيس المحدودة من: “دور بريون” البروتين-EGFR مجمع مولتيموليكولار خلال تمايز الخلايا العصبية لطب الأسنان المستمدة من اللب الخلايا الجذعية البشرية. مارتيلوكسي، س.، Manganelli ف، جيم سانتاكروس، واو سانتيلي، لام بيكولي، م. سوريسي، وخامساً ماتيي بريون. 4 مارس عام 2018. تايلور وفرانسيس المحدودة.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Referências
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
