अलगाव, प्रचार, और मानव दंत लुगदी स्टेम कोशिकाओं के Neuronal भेदभाव के दौरान Prion प्रोटीन अभिव्यक्ति
Summary
यहां हम मानव दंत पल्प स्टेम सेल अलगाव और प्रसार के लिए एक प्रोटोकॉल प्रस्तुत क्रम में न्यूरोनल भेदभाव प्रक्रिया के दौरान prion प्रोटीन अभिव्यक्ति का मूल्यांकन करने के लिए ।
Abstract
भ्रूणीय स्टेम कोशिकाओं के हेरफेर से संबंधित Bioएथिकल मुद्दों चिकित्सा अनुसंधान के क्षेत्र में प्रगति रुकावट है । इस कारण से, यह बहुत महत्वपूर्ण है के लिए विभिंन ऊतकों से वयस्क स्टेम सेल प्राप्त करने के लिए इस तरह के रूप में वसा, गर्भनाल, अस्थि मज्जा और रक्त । संभव सूत्रों के अलावा, दंत लुगदी विशेष रूप से यह bioएथिकल विचारों के संबंध में प्राप्त करने के लिए आसान है, क्योंकि दिलचस्प है । दरअसल, मानव दंत पल्प स्टेम सेल (hDPSCs) वयस्क स्टेम कोशिकाओं के एक प्रकार के न्यूरोनल की तरह कोशिकाओं में अंतर कर रहे हैं और स्वस्थ रोगियों (13-19 उम्र) के तीसरे दाढ़ से प्राप्त किया जा सकता है. विशेष रूप से, दंत लुगदी एक खुदाई के साथ हटा दिया गया था, छोटे स्लाइस में कटौती, कोलेलेनज़ चतुर्थ के साथ इलाज किया और एक फ्लास्क में सभ्य । न्यूरोनल भेदभाव को प्रेरित करने के लिए, hdpscs 2 सप्ताह के लिए egf/bfgf के साथ उत्तेजित थे । पहले, हमने दर्शाया है कि विभेद की प्रक्रिया के दौरान hDPSCs में सेलुलर प्रिऑन प्रोटीन (पीआरपीसी) की सामग्री बढ़ गई । cytofluorimetric विश्लेषण पीआरपीसी की एक प्रारंभिक अभिव्यक्ति है कि न्यूरोनल भेदभाव प्रक्रिया के बाद वृद्धि दिखाई । सिरना पीआरपी के द्वारा पीआरपीसी का अपघर्षण रोके जाने से एजीएफ/बीएफजीएफ द्वारा प्रेरित न्यूरोनल विभेशिएशन को रोका गया । इस पत्र में हम इस बात को स्पष्ट करते हैं कि जैसा कि हमने अलगाव, पृथक्करण और कई आसान प्रक्रियाओं के साथ hdpscs के विट्रो खेती विधियों में वृद्धि की है, और अधिक कुशल सेल क्लोन प्राप्त किए गए थे और बड़े पैमाने पर विस्तार मध्योतक स्टेम सेल (एमएससीएस) मनाया गया । हम यह भी बताएंगे कि कैसे, प्रोटोकॉल में विस्तृत विधियों से प्राप्त hDPSCs, एमएससीएस की न्यूरोनल विभेशन प्रक्रिया और बाद में सेलुलर और आण्विक प्रक्रियाओं का अध्ययन करने के लिए एक उत्कृष्ट प्रायोगिक मॉडल हैं ।
Introduction
mesenchymal स्टेम सेल कई ऊतकों से अलग किया गया है, अस्थि मज्जा सहित, गर्भनाल रक्त, मानव दंत लुगदी, वसा ऊतक, और रक्त1,2,3,4,5 , 6. के रूप में कई लेखकों द्वारा रिपोर्ट, hDPSCs प्लास्टिक पालन, एक ठेठ फाइब्रोब्लास्ट की तरह morphology दिखाओ । ये अलग क्लोन और प्रफलन और फर्क क्षमता7,8में अंतर के साथ एक उच्च विषम जनसंख्या का प्रतिनिधित्व करते हैं । मध्योतक स्टेम सेल (यानी CD44, CD90, CD73, CD105, स्ट्रो-1) के लिए विशिष्ट मार्कर एक्सप्रेस hdpscs, वे (जैसे CD14 और CD19) और इन विट्रो multiवंशावली भेदभाव9 में सक्षम हैं, कुछ टेम मार्कर के लिए नकारात्मक हैं 10,11.
कई लेखकों को पता चला है कि इन कोशिकाओं को अलग प्रोटोकॉल का उपयोग कर neuron की तरह कोशिकाओं में अंतर करने में सक्षम हैं, कि ngf, bfgf, विशिष्ट मीडिया और पूरक7,12के साथ संयोजन में egf के अलावा शामिल हैं । इसके अलावा, कई प्रोटीन न्यूरोनल भेदभाव प्रक्रिया के दौरान शामिल है और, इन के अलावा, कई कागजात एक प्रासंगिक भूमिका और सेलुलर prion प्रोटीन की महत्वपूर्ण अभिव्यक्ति (पीआरपीसी), दोनों भ्रूण और वयस्क स्टेम सेल13में दिखाते हैं, 14. पीआरपीसी एक बहुप्रभावी तांबे चयापचय के रूप में कोशिकाओं के अंदर विभिन्न कार्यों का प्रदर्शन करने में सक्षम अणु का प्रतिनिधित्व करता है, अपोप्टोसिस, और oxidative तनाव के लिए प्रतिरोध15,16,17 , 18 , 19 , 20 , 21 , 22.
हमारे पिछले23पेपर में, हम hDPSCs न्यूरोनल भेदभाव की प्रक्रिया में पीआरपीसी की भूमिका की जांच की । वास्तव में, hdpscs एक्सप्रेस precociously prpसी और, न्यूरोनल भेदभाव के बाद, यह एक अतिरिक्त वृद्धि का पालन करने के लिए संभव था. अंय लेखकों स्टेम सेल के न्यूरोनल भेदभाव प्रक्रियाओं में पीआरपीसी की एक संभावित भूमिका डोडो । दरअसल, पीआरपीसी मानव भ्रूण स्टेम कोशिकाओं के न्यूरॉन्स, ओलिगोडेन्ट्रोसाइट्स, और astrocytes में भेदभाव ड्राइव24. इस अध्ययन का उद्देश्य दंत लुगदी से स्टेम सेल प्राप्त करने के लिए कार्यप्रणाली पर जोर देना था, इसके विभेद की प्रक्रिया और न्यूरोनल विभेद के दौरान पीआरपीसी की भूमिका.
Protocol
Representative Results
Discussion
इस काम में, हम अलगाव और hdpscs के न्यूरोनल भेदभाव के लिए कार्यप्रणाली पर ध्यान केंद्रित; इसके अलावा, हम इस प्रक्रिया में पीआरपीसी की भूमिका का मूल्यांकन किया । अलग करने और इस प्रक्रिया के दौरान न्यूरोऑ?…
Declarações
The authors have nothing to disclose.
Acknowledgements
इस काम के द्वारा समर्थित किया गया था “Fondazione वार्षिन” और Rieti विश्वविद्यालय हब “सबीना विश्विद्यालय” को Vincenzo Mattei.
चित्र 5 (A, B) प्रकाशक टेलर & फ्रांसिस लिमिटेड की अनुमति से पुनर्मुद्रित: मानव दंत लुगदी व्युत्पन्न स्टेम कोशिकाओं के न्यूरोनल भेदभाव के दौरान prion प्रोटीन की भूमिका-egfr बहुआण्विक परिसर । मार्टेलुची, एस., मैंगनेल्ली वी., Santacroce सी., सैंटिल्लि एफ, पिकोली एल, सोरिस एम., Mattei वी. Prion. २०१८ मार्च 4. टेलर & फ्रांसिस लिमिटेड
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Referências
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
