오가노이드 유래 상피 단층: 장 장벽 기능을 위한 임상적으로 관련된 시험관내 모델
Summary
여기에서, 우리는 장 장벽 기능, 투과성 및 수송을 연구하기 위한 인간 오가노이드 유래 장 상피 단층의 제조를 기술한다. 오가노이드가 외부 자극에 대한 원래의 상피 조직 반응을 나타내기 때문에, 이들 모델은 세포주의 확장성과 일차 조직의 관련성 및 복잡성의 이점을 결합한다.
Abstract
과거에는 장 상피 모델 시스템이 형질전환 세포주 및 일차 조직으로 제한되었습니다. 이들 모델 시스템은 전자가 원래의 조직 생리학을 충실하게 나타내지 않기 때문에 내재적인 한계를 가지며, 후자의 이용가능성은 제한된다. 따라서 그들의 응용 프로그램은 기초 및 약물 개발 연구를 방해합니다. 성인 줄기 세포 기반 오가노이드 (이하 오가노이드라고 함)는 그들이 파생 된 정상 또는 병든 상피 조직의 미니어처입니다. 이들은 상이한 위장관 (GI) 관 영역에서 매우 효율적으로 확립될 수 있고, 장기간의 확장성을 가지며, 시험관내 치료에 대한 조직 및 환자 특이적 반응을 시뮬레이션할 수 있다. 여기서, 장 유래 오가노이드 유래 상피 단층의 확립은 상피 장벽 완전성, 투과성 및 수송성, 항균 단백질 분비 및 조직학을 측정하는 방법과 함께 입증되었다. 또한, 장 유래 오가노이드 단층은 증식하는 줄기 및 경이 증폭 세포뿐만 아니라 주요 분화 된 상피 세포로 농축 될 수 있습니다. 따라서, 이들은 표적 세포에 대한 화합물의 효과 및 그들의 작용 방식을 연구하도록 맞춤화될 수 있는 모델 시스템을 나타낸다. 오가노이드 배양은 세포주보다 기술적으로 더 까다 롭지 만, 일단 확립되면 생체 내 상피 복잡성과 환자 간 이질성을 진정으로 나타내기 때문에 약물 개발의 후기 단계에서 실패를 줄일 수 있습니다.
Introduction
장 상피는 장의 발광 함량과 기저 조직 사이의 물리적 장벽 역할을합니다. 이 장벽은 인접한 세포 사이에 강한 세포 간 연결을 확립하는 단단한 접합에 의해 연결되는 주로 흡수성 장세포의 단일 상피층을 포함한다. 이 세포들은 장의 정점 (루멘)과 기저변을 분리하는 편광 상피 내막을 형성하면서 동시에 소화 된 영양소와 대사 산물의 부세포 수송을 조절합니다. 장세포 이외에, 잔, 파네스 및 장내분비 세포와 같은 다른 중요한 상피 세포도 점액, 항균 펩티드 및 호르몬을 각각 생산함으로써 장 항상성에 기여한다. 장 상피는 류신이 풍부한 반복 함유 G-단백질 결합 수용체 5 양성 (LGR5+) 줄기 세포를 장내 크립트의 바닥에 나누어 지속적으로 보충하여 위쪽으로 이동하여 다른 세포 유형으로 분화되는 트랜스 증폭 (TA) 세포를 생산합니다1. 식품 알레르겐, 의약 화합물 및 미생물 병원균에 대한 노출과 같은 유전 적 및 환경 적 요인에 의한 장 상피 항상성의 붕괴는 장 장벽 기능의 중단으로 이어집니다. 이러한 상태는 염증성 장 질환 (IBD), 체강 질환 및 약물 유발 GI 독성2를 포함한 여러 장 질환을 유발합니다.
장 상피에 대한 연구는 막 삽입물, 장기 온 칩 시스템, Ussing 챔버 및 장 링과 같은 여러 시험관 내 플랫폼 시스템을 사용하여 수행됩니다. 이들 플랫폼은 형질전환된 세포주 또는 일차 조직을 모델로서 사용하여 막의 정점 및 기저측 양쪽 모두에 접근할 수 있는 편광된 상피 단층을 확립하는데 적합하다. 대장(adeno)암종 세포주인 Caco-2, T84 및 HT-29와 같은 형질전환 세포주는 어느 정도 편광된 장내세포 또는 점액 생성 세포로 분화할 수 있지만, 이들은 여러 세포 유형이 누락되고 다양한 수용체 및 운반체가 비정상적으로 발현됨에 따라 생체내 상피를 대표하지 않는다3 . 또한, 세포주는 단일 공여체로부터 유래되기 때문에, 이들은 환자간 이질성을 나타내지 않으며 감소된 복잡성 및 생리학적 관련성을 겪는다. Ussing 챔버 및 장 고리로 사용되는 일차 조직은 생체 내 상황을 더 대표하지만, 제한된 가용성, 단기 생존력 및 확장성 부족으로 인해 고처리량 (HT) 연구를위한 매개체로 부적합합니다.
오가노이드는 장, 신장, 간, 췌장 및 폐와 같은 다른 기관으로부터 확립된 시험관내 상피 배양물이다. 그들은 장기적이고 안정적인 확장성뿐만 아니라 유전 적 및 표현형 안정성을 갖는 것으로 입증되었으므로 외부 자극에 충실한 반응을 보이는 원래 기관의 상피의 대표적인 생물학적 미니어처입니다 4,5,6,7,8,9. 오가노이드는 절제되거나 생검된 정상, 병, 염증 또는 암성 조직으로부터 효율적으로 확립되며, 이질적인 환자 특이적 반응10,11,12,13,14,15,16을 나타낸다. 이 논문은 오가노이드 문화에서 유래 된 장 상피 단층을 확립하는 방법을 보여줍니다. 단층은 소장뿐만 아니라 결장 및 직장 오가노이드 문화에서 성공적으로 확립되었습니다. 이 모델은 상피 세포가 약물에 대한 수송 및 투과성뿐만 아니라 상피에 대한 독성 학적 영향을 연구 할 수있는 기회를 창출합니다. 또한이 모델은 면역 세포 및 박테리아와의 공동 배양을 통해 장 상피와의 상호 작용을 연구 할 수 있습니다17,18,19. 또한,이 모델은 환자 특정 방식으로 치료법에 대한 반응을 연구하고 상피 장벽 중심의 치료제의 다음 물결을 찾기 위해 스크리닝 노력을 시작하는 데 사용될 수 있습니다. 이러한 접근법은 클리닉으로 확장 될 수 있으며 개인화 된 치료를위한 길을 닦을 수 있습니다.
이 프로토콜의 상피 단층은 인간 정상 장 오가노이드로부터 제조되지만, 프로토콜은 다른 오가노이드 모델에 적용되고 최적화될 수 있다. 상피 오가노이드 단층은 줄기 세포 증식을 지원하고 장내 크립트 세포 조성물을 나타내기 위해 Wnt를 함유하는 장내 오가노이드 확장 배지에서 배양된다. 장내 오가노이드는 Wnt, Notch 및 표피 성장 인자 (EGF) 경로를 조절함으로써 장내분비 세포, 파네스, 잔 및 장내분비 세포와 같은 상이한 장 상피 운명을 갖도록 농축될 수 있다. 여기서, 확장 배지에서 단층의 확립 후에, 이들은 이전에 기술된 바와 같이 더 분화된 장 상피 세포,20,21,22,23,24,25로 구동된다. 스크리닝 목적을 위해, 관심있는 화합물의 작용 모드, 그의 표적 세포, 및 실험 조건에 따라, 단층은 관련 기능적 판독을 갖는 화합물의 효과를 측정하기 위해 선택된 세포 조성을 향해 구동될 수 있다.
Protocol
Representative Results
Discussion
이 프로토콜은 장 오가노이드의 일반적인 조작 및 유지뿐만 아니라 이러한 오가노이드로부터 유래된 상피 단일층의 준비 및 가능한 응용을 기술한다. 현재까지, 단층은 십이지장, 장폐색 및 정상 뿐만 아니라 이전에 그리고 활발하게 염증을 일으킨 장 조직으로부터 유래된 결장 오가노이드의 상이한 영역으로부터 성공적으로 제조되었다(공개되지 않은 데이터). 환자 유래 오가노이드 단일층의 ?…
Declarações
The authors have nothing to disclose.
Acknowledgements
이 작업은 Topsector Life Sciences & Health – Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) 공공 – 민간 파트너십 (PPP) 프로젝트 번호 LSHM16021 Organoids와 함께 네덜란드 LSH 부문의 수당을 Hubrecht Organoid Technology (HUB) 및 HUB 내부 자금 조달 질병 모델링 및 독성학 부서에 대한 독성학 모델링을위한 새로운 도구로 지원합니다. 우리는 Sabine Middendorp (소아 위장병학, Wilhelmina Children ‘s Hospital, UMC, Utrecht)와 Hugo R. de Jonge와 Marcel J.C. Bijvelds (위장병 및 간학과, Erasmus MC, Rotterdam)의 실험실에 멤브레인 삽입물에 단층을 설정하는 초기 기술 지원을 제공 한 것에 감사드립니다.
Materials
| 100% ethanol | Fisher Emergo | 10644795 | |
| 1250, 300, and 20 µL low-retention filter-tips | Greiner bio-one | 732-1432 / 732-1434 / 732-2383 | |
| 15 mL conical tubes | Greiner bio-one | 188271 | |
| 24-well cell culture plates | Greiner bio-one | 662160 | |
| 24-well HTS Fluoroblok Transwell plate (light-tight) | Corning | 351156 | Plates require REMS AutoSampler for TEER measurements |
| 24-well HTS Transwell plates (Table 1) | Corning | 3378 | |
| 24-well plate with Transwell inserts | Corning | 3470 | membrane inserts |
| 40 µm cell strainer | PluriSelect | 43-50040-01 | |
| 50 mL conical tubes | Greiner bio-one | 227261 | |
| 6-well cell culture plates | Greiner bio-one | 657160 | |
| 96-well black plate transparent bottom | Greiner bio-one | 655090 | |
| 96-well fast thermal cycling plates | Life Technologies Europe BV | 4346907 | |
| 96-well HTS Fluoroblok Transwell plate | Corning | 351162 | |
| 96-well HTS Transwell plates (Table 1) | Corning | 7369 | |
| 96-well transparent culture plate | Greiner bio-one | 655180 | |
| A83-01 | Bio-Techne Ltd | 2939 | |
| Accutase Cell Dissociation Reagent | Life Technologies Europe BV | A11105-01 | |
| Advanced DMEM/F-12 | Life Technologies Europe BV | 12634028 | |
| B27 supplement | Life Technologies Europe BV | 17504001 | |
| Cell culture microscope (light / optical microscope) | Leica | ||
| CellTiter-Glo | Promega | G9683 | |
| Centrifuge | Eppendorf | ||
| CO2 incubator | PHCBI | ||
| DAPT | Sigma-Aldrich | D5942 | |
| DEPC treated H2O | Life Technologies Europe BV | 750024 | |
| Dulbecco's phosphate-buffered saline (DPBS) with Ca2+ and Mg2+ | Life Technologies Europe BV | 14040091 | |
| DPBS, powder, no calcium, no magnesium | Life Technologies Europe BV | 21600069 | |
| EnzChek Lysozyme Assay Kit | Life Technologies Europe BV | E22013 | |
| EVOM2 meter with STX electrode | WTI | ||
| Gastrin | Bio-Techne Ltd | 3006 | |
| Glass pipettes | Volac | ||
| GlutaMAX | Life Technologies Europe BV | 35050038 | |
| hEGF | Peprotech | AF-100-15 | |
| HEPES | Life Technologies Europe BV | 15630056 | |
| Human Noggin | Peprotech | 120-10C | |
| Human Rspo3 | Bio-Techne Ltd | 3500-RS/CF | |
| IWP-2 | Miltenyi Biotec | 130-105-335 | |
| Ki67 primary antibody | Sanbio | BSH-7302-100 | |
| Ki67 secondary antibody | Agilent | K400111-2 | |
| Kova International Glasstic Slide with Counting grids | Fisher Emergo | 10298483 | |
| Laminar flow hood | Thermo scientific | ||
| Lucifer Yellow CH dilithium salt | Sigma-Aldrich | L0259 | |
| Matrigel, Growth Factor Reduced (GFR) | Corning | 356231 | extracellular matrix (ECM) |
| MicroAmp Fast 8-Tube Strip, 0.1 mL | Life Technologies Europe BV | 4358293 | |
| MicroAmp Optical 8-Cap Strips | Life Technologies Europe BV | 4323032 | |
| Microcentrifuge tubes | Eppendorf | 0030 120 086 | |
| Micropipettes (1000, 200, and 20 µL) | Gilson | ||
| Microtome | Leica | ||
| MUC2 primary antibody | Santa Cruz Biotechnology | sc-15334 | |
| MUC2 secondary antibody | VWR | VWRKS/DPVR-HRP | |
| Multichannel pipette (200 µL) | Gilson | ||
| N-acetylcysteine | Sigma-Aldrich | A9165 | |
| NGS Wnt | U-Protein Express | N001-0.5mg | |
| Nicotinamide | Sigma-Aldrich | N0636 | |
| Oligonucleotide ALPI1/Forward | Custom-made | GGAGTTATCCTGCTCCCCAC | |
| Oligonucleotide ALPI1/Reverse | Custom-made | CTAGGAGGTGAAGGTCCAACG | |
| Oligonucleotide LGR5/Forward | Custom-made | ACACGTACCCACAGAAGCTC | |
| Oligonucleotide LGR5/Reverse | Custom-made | GGAATGCAGGCCACTGAAAC | |
| Oligonucleotide MUC2/Forward | Custom-made | AGGATCTGAAGAAGTGTGTCACTG | |
| Oligonucleotide MUC2/Reverse | Custom-made | TAATGGAACAGATGTTGAAGTGCT | |
| Oligonucleotide TBP/Forward | Custom-made | ACGCCGAATATAATCCCAAGCG | |
| Oligonucleotide TBP/Reverse | Custom-made | AAATCAGTGCCGTGGTTCGTG | |
| Optical adhesive covers | Life Technologies Europe BV | 4311971 | |
| PD0325901 | Stemcell Technologies | 72184 | |
| Penicillin/streptomycin | Life Technologies Europe BV | 15140122 | |
| Plate shaker | Panasonic | ||
| PowerUp SYBR Green Master Mix | Fisher Emergo | A25776 | |
| Primocin | InvivoGen | ANT-PM-2 | antimicrobial formulation for primary cells |
| Qubit RNA HS Assay Kit | Life Technologies Europe BV | Q32852 | |
| Reagent reservoir for multichannel pipet | Sigma-Aldrich | CLS4870 | |
| REMS AutoSampler with 24-probe or 96C-probe | WTI | ||
| Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit | Thermo scientific | 87023 | |
| RNase-Free DNase Set | Qiagen | 79254 | |
| RNeasy Mini Kit | Qiagen | 74106 | |
| SB202190 | Sigma-Aldrich | S7076 | |
| Serological pipettes | Greiner bio-one | 606180 / 607180 / 760180 | |
| Serological pipettor (Pipet-Aid) | Drummond | ||
| Single edge razor blade | GEM Scientific | ||
| Superscript 1st strand system for RT-PCR | Life Technologies Europe BV | 11904018 | |
| Tecan Spark 10M plate reader | Tecan | ||
| Trypan Blue Solution, 0.4% | Life Technologies Europe BV | 15250-061 | |
| TrypLE Express Enzyme (1x) | Life Technologies Europe BV | 12605-010 | Cell dissociation reagent |
| Water bath | Grant | ||
| Y27632 (ROCK inhibitor) | AbMole | M1817 |
Referências
- Haegebarth, A., Clevers, H. Wnt signaling, lgr5, and stem cells in the intestine and skin. The American Journal of Pathology. 174 (3), 715-721 (2009).
- Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. The intestinal barrier and current techniques for the assessment of gut permeability. Cells. 9 (8), 1909 (2020).
- Martínez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. HT29 Cell Line. The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
- Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett’s epithelium. Gastroenterology. 141 (5), 1762-1772 (2011).
- Huch, M., et al. In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration. Nature. 11 (2), 179-194 (2013).
- Sachs, N., et al. Long-term expanding human airway organoids for disease modeling. The EMBO Journal. 38 (4), 1-20 (2019).
- Karthaus, W. R., et al. Identification of multipotent luminal progenitor cells in human prostate organoid cultures. Cell. 159 (1), 163-175 (2014).
- Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1-2), 324-338 (2015).
- Sachs, N., et al. A living biobank of breast cancer organoids captures disease heterogeneity. Cell. 172 (1-2), 373-386 (2018).
- Vlachogiannis, G., et al. Patient-derived organoids model treatment response of metastatic gastrointestinal cancers. Science. 359 (6378), 920-926 (2018).
- Van De Wetering, M., et al. Prospective derivation of a living organoid biobank of colorectal cancer patients. Cell. 161 (4), 933-945 (2015).
- Driehuis, E., et al. Pancreatic cancer organoids recapitulate disease and allow personalized drug screening. Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).
- Tiriac, H., et al. Organoid profiling identifies common responders to chemotherapy in pancreatic cancer. Cancer Discovery. 8 (9), 1112-1129 (2018).
- d’Aldebert, E., et al. Characterization of human colon organoids from inflammatory bowel disease patients. Frontiers in Cell and Developmental Biology. 8, 363 (2020).
- Dotti, I., et al. Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis. Gut. 66 (12), 2069-2079 (2017).
- VanDussen, K. L., et al. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut. 64 (6), 911-920 (2015).
- Noel, G., et al. A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions. Scientific Reports. 7, 45270 (2017).
- Bartfeld, S., et al. In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection. Gastroenterology. 148 (1), 126-136 (2015).
- van Es, J. H., et al. Wnt signalling induces maturation of Paneth cells in intestinal crypts. Nature Cell Biology. 7 (4), 381-386 (2005).
- van Es, J. H., et al. Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage. Nature Cell Biology. 14 (10), 1099-1104 (2012).
- de Lau, W. B. M., Snel, B., Clevers, H. C. The R-spondin protein family. Genome Biology. 13 (3), 1-10 (2012).
- Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells. Cell Stem Cell. 20 (2), 177-190 (2017).
- Beumer, J., et al. Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient. Nature Cell Biology. 20 (8), 909-916 (2018).
- Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny. Nature Methods. 11 (1), 106-112 (2014).
- Boj, S. F., et al. Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients. Journal of Visualized Experiments. (120), (2017).
- Miao, Y., et al. Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo. Cell Stem Cell. 27 (5), 840-851 (2020).
- Srinivasan, B., et al. TEER measurement techniques for in vitro barrier model systems. Journal of Laboratory Automation. 20 (2), 107-126 (2015).
- Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability. Die Pharmazie. 65 (1), 19-24 (2010).
- Lea, T., Verhoeckx, K., et al. Caco-2 cell line. The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).
- Heo, I., et al. Modelling Cryptosporidium infection in human small intestinal and lung organoids. Nature Microbiology. 3 (7), 814-823 (2018).
- Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25 (6), 681-686 (2007).
