Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression
Published: April 30, 2023
Abstract
Source: Hsiao, Y. L., et al. Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro. J. Vis. Exp. (2022).
In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs).
Protocol
1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs) Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 μM β-estradiol. Passage the cells at a ratio of 1:10 every 3 days. NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x10-5 M β-mercaptoethanol, and 10 μg/mL gentamicin. Recombinant murine FL is also commercially available….
Representative Results
Figure 1: The construct of lentiviral vector pLKO.1-Puro.
Disclosures
The authors have nothing to disclose.
Materials
| 1.5 mL Micro tube | ExtraGene | TUBE-170-C | |
| 12-well tissue culture-treated plate | Falcon | 353043 | |
| Fetal bovine serum (FBS) | Corning | 35-010-CV | |
| RPMI 1640 medium | Gibco | 11875-085 | |
| β-estradiol | Sigma-Aldrich | E2758-250MG | |
| β-mercaptoethanol (β-ME) | Sigma-Aldrich | M6250 | |
| Flt3 ligand (FL) | Home-made | ||
| Polybrene | Sigma-Aldrich | TR-1003-G | |
| Puromycin | Invivogen | ant-pr-1 | |
| shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390) | The RNAi Consortium (TRC) | ||
| shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224) | The RNAi Consortium (TRC) | ||
| shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094) | The RNAi Consortium (TRC) |
Tags
Cite This Article
Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression. J. Vis. Exp. (Pending Publication), e20969, doi: (2023).