Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.
Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.
Global kylling produktion er tidoblet i løbet af de sidste 50 år med udviklingslandene hosting næsten fire gange udvidelsen vidne i den udviklede verden (www.faostat.org) . Da relevansen af kylling produktion til fødevaresikkerheden på verdensplan er vokset så også har profilen af patogener, som kan forårsage alvorlig sygdom hos kyllinger. Et godt eksempel er de Eimeria arter, allestedsnærværende protozoparasitter der kan forårsage den enteriske sygdom coccidiose 1. Hvor kyllinger opdrættes en eller flere Eimeria-arter er sandsynligvis være fælles 2-4. I den udviklede verden Eimeria er primært styret af kemoprofylakse, beskæftiger shuttle eller rotation programmer til at minimere konsekvenserne af resistens 5. Levende vacciner bruges også i systemer, hvor fugl værdi er tilstrækkelig til at retfærdiggøre udgifterne (f.eks avlsdyr, lag og nogle slagtekyllinger 5). Som result af disse foranstaltninger klinisk coccidiose ofte velkontrollerede, selvom subklinisk infektion er almindelig 5. I udviklingslandene vaccination er sjælden og narkotika ansøgning ofte mindre godt informeret. Som en konsekvens subklinisk og klinisk coccidiose er mere almindelig og udøver en betydelig økonomisk virkning 3.
Diagnose af eimerian infektion har traditionelt påberåbt læsion scorer post mortem, selvom selv de forfattere mest udbredte pointsystem kommenterede, at for nogle arter "er det tvivlsomt, om en sådan procedure bør forsøges i enhver men moderat svære infektioner" 6. Supplerende dokumentation kan samles ved en mikroskopisk påvisning af den miljømæssigt resistente oocyst livscyklus etape i gødningsprøver eller kuld prøver, selv om overlappende morfologi kan forvirre alle, men eksperten 6,7. Molekylære alternativer ved hjælp af polymerasekædereaktion (PCR), tilfældig amplification af polymorfe DNA PCR (RAPD-PCR) og kvantitative PCR-teknologier har været tilgængelige i op til 20 år 8-10, men til dato de har undladt at blive populær. Relativ regning og kravet om specialiseret laboratorieudstyr eller forarbejdning har begrænset deres optagelse på trods af ofte subjektive og teknisk krævende karakter ældre pathology- og mikroskopi tilgange 10,11. Sådanne begrænsninger kan være overdrevet i mange af de fattigere regioner i verden, såsom Sydøstasien, hvor virkningen af coccidiose på fattigdommen kan være forholdsmæssigt større 12. Som svar er der et klart behov for nye ligetil og følsom, men omkostningseffektive, Eimeria Artsspecifikke diagnostiske analyser.
Loop-medieret isotermisk amplifikation (lampe) er en nem at fremstille DNA-polymerase-driven teknik, der er i stand til at amplificere store mængder DNA. Vigtigst bruger LAMP et Bst DNA polymeraSE stedet for Taq-DNA-polymerase er almindeligt anvendt i PCR, hvilket letter DNA-amplifikation ved en enkelt konstant temperatur uden kravet om termisk cykling 13,14. Lampen kan gøres til genstand for ansøgning i selv de mest rudimentære laboratorium eller i felten. Karakteriseret ved relativ resistens over for mange PCR-inhibitorer, høj følsomhed og specificitet, er blevet udviklet LAMP assays for en bred vifte af patogener, herunder infektiøs bursal disease virus, Clostridium perfringens og Cryptosporidium 15-17. Som svar på efterspørgslen efter nye omkostningseffektive Eimeria Artsspecifikke diagnostik et panel af LAMP assays er specifikke for hver af de syv Eimeria arter, der inficerer kyllinger er udviklet 18. Ansøgninger om de nye analyser omfatte overvågning parasit forekomst, af særlig værdi i betragtning af den sammenslutning af arter som Eimeria maxima eller Eimeria necatrix med dårlige økonomiske performance 3,4. Andre anvendelsesområder omfatter vurdering af effektiviteten af en bedrifts anticoccidial strategi, diagnosticering af subklinisk infektion eller klinisk sygdom og evaluering af risiko, som Eimeria til en gård.
The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~£0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment.
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25.
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.
The authors have nothing to disclose.
The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.
Name | Company | Catalogue number | Comments |
RNAlater | Ambion | AM7024 | |
Ethanol | VWR Chemicals | 20821.321 | Caution, highly flammable |
100 x Tris-EDTA (TE) buffer concentrate | Sigma-Aldrich | T9285 | |
Chelex 100 resin | Bio-Rad | 142-1253 | |
Molecular grade water | Invitrogen | 10977035 | |
E. acervulina F3 | Sigma-Aldrich | VC00021 | *CCTAACATTTCGCTTCACGGAC |
E. acervulina B3 | Sigma-Aldrich | VC00021 | *ATGAGCAAGTGGAACACCTTG |
E. acervulina FIP | Sigma-Aldrich | VC00021 | *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT |
E. acervulina BIP | Sigma-Aldrich | VC00021 | *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG |
E. acervulina LB | Sigma-Aldrich | VC00021 | *TAAGGTTACACCCGTGGAGG |
E. acervulina LF | Sigma-Aldrich | VC00021 | *GCCATGCACAAAGCGACTT |
E. brunetti F3 | Sigma-Aldrich | VC00021 | *GGCCATCAAGTTCCATGAGC |
E. brunetti B3 | Sigma-Aldrich | VC00021 | *TCAACCTCCTGAGTGTGGTT |
E. brunetti FIP | Sigma-Aldrich | VC00021 | *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT |
E. brunetti BIP | Sigma-Aldrich | VC00021 | *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC |
E. brunetti LB | Sigma-Aldrich | VC00021 | *GAAACGCTCGAACATGGC |
E. brunetti LF | Sigma-Aldrich | VC00021 | *CTTCTCCACAGACCCAGAGGT |
E. maxima F3 | Sigma-Aldrich | VC00021 | *ACTACGGAAAAGTGCGTAGCT |
E. maxima B3 | Sigma-Aldrich | VC00021 | *CCTTCCTCCCTTCTGAAAACTG |
E. maxima FIP | Sigma-Aldrich | VC00021 | *GAGTCACTGCTGATGTACCAAA AG-GAACTATGCCGCTTTCCCCTG |
E. maxima BIP | Sigma-Aldrich | VC00021 | *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA |
E. maxima LB | Sigma-Aldrich | VC00021 | *CAAGCCTACGCGGACATC |
E. maxima LF | Sigma-Aldrich | VC00021 | *TTATGCAGCTGGGTCAACG |
E. mitis F3 | Sigma-Aldrich | VC00021 | *ACGATAGCCAAGACACGTAAGG |
E. mitis B3 | Sigma-Aldrich | VC00021 | *CCCCGTGATAAGAGTAGGAACA |
E. mitis FIP | Sigma-Aldrich | VC00021 | *CGCGGGTCGTGAGATTTAAATT AT-GGAAGATCAGGACGGGCACT |
E. mitis BIP | Sigma-Aldrich | VC00021 | *GTTTCAGTTGATGAACAAGCGA GA-TGCGCCTCTAGAATCAAGACG |
E. mitis LB | Sigma-Aldrich | VC00021 | *TCCATGCATCCCCTTGTT |
E. mitis LF | Sigma-Aldrich | VC00021 | *CGTGGGCACAGATTGATTC |
E. necatrix F3 | Sigma-Aldrich | VC00021 | *TGGCTTTCCCGCGTACC |
E. necatrix B3 | Sigma-Aldrich | VC00021 | *CGGCCCAACACAAAGACTG |
E. necatrix FIP | Sigma-Aldrich | VC00021 | *CGCTTGAGTTTTAAGCTATGCA CA-GACCCAAGCAGCTCACCAA |
E. necatrix BIP | Sigma-Aldrich | VC00021 | *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC |
E. necatrix LB | Sigma-Aldrich | VC00021 | *GTCTGTAACTTGGGACGTTGT |
E. necatrix LF | Sigma-Aldrich | VC00021 | *GAACAGCCGGAGCCTCTC |
E. praecox F3 | Sigma-Aldrich | VC00021 | *GCCCTTGTATGTTGCTGTTTCT |
E. praecox B3 | Sigma-Aldrich | VC00021 | *GCGCACGAATCTGAATCACAC |
E. praecox FIP | Sigma-Aldrich | VC00021 | *ATCTCCTCAAAGACTTTCGCGT A-GCGCTTGGCTATATCCATAGG |
E. praecox BIP | Sigma-Aldrich | VC00021 | *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT |
E. praecox LB | Sigma-Aldrich | VC00021 | *GAATAGCATTGCCAGGTGG |
E. praecox LF | Sigma-Aldrich | VC00021 | *GTCCACTGTCATTAATATTGC TGC |
E. tenella F3 | Sigma-Aldrich | VC00021 | *GCTTGTGAAGGTCAGCGTG |
E. tenella B3 | Sigma-Aldrich | VC00021 | *GCTGAGTCCATACGTACTTCCT |
E. tenella FIP | Sigma-Aldrich | VC00021 | *GCCACTGCTATGGAAAGTCAC AC-CATAACTGGCATGCAGGGGT |
E. tenella BIP | Sigma-Aldrich | VC00021 | *GTTTGGCCCGAAAGTTGTGAA GA-CGTCAGAAATTGCTGCCCAAT |
E. tenella LB | Sigma-Aldrich | VC00021 | *CGCATGTGCAGTTGAAGACA |
E. tenella LF | Sigma-Aldrich | VC00021 | *CCAAATGTATCTGCTAGTTATA TTAACAAG |
10 x ThermoPol reaction buffer | New England Biolabs | B9004S | |
MgSO4 | Sigma-Aldrich | M7506 | |
dNTPs | Promega | U1330 | |
Betaine solution (5 M) | Sigma-Aldrich | B0300 | |
Bst polymerase | New England Biolabs | M0275S | |
Hydroxynaphthol blue | Sigma-Aldrich | 33936 | Dissolved in molecular grade water. |
UltraPure agarose | Invitrogen | 16500-500 | |
10 x Tris/Borate/EDTA (TBE) buffer | Invitrogen | AM9863 | |
Blue/Orange DNA loading dye (x6) | Promega | G1881 | |
GeneRuler 1Kb DNA ladder | Thermo Scientific | SM0313 | |
SafeView nucleic acid stain | NBS Biologicals | NBS-SV |