Summary

تحريض الأم المناعي التنشيط في الفئران في مرحلة منتصف الحمل مع الفيروسية تقليد بولي (I: C)

Published: March 25, 2016
doi:

Summary

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Abstract

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Introduction

مفهوم التنشيط المناعي للأم (MIA) تنبع من الدراسات الوبائية على جمعية إصابة الأم بمرض التوحد وانفصام الشخصية 1. نظرا لعدم وجود مسببات الأمراض الفيروسية تكرار اكتشافها في المشيمة أو دماغ الجنين بعد عدوى فيروسية الأمهات 2،3، على فرضية تأثير الإصابة على ذرية أن يكون سبب تنشيط الجهاز المناعي للأم بدلا من مسببات الأمراض أنفسهم .

لإلقاء الضوء على العلاقة بين السبب والنتيجة بين وزارة الداخلية والاضطرابات النفسية، حقن تصنيعه كيميائيا، الفيروسية تقليد ضعف polyinosinic الحمض النووي الريبي RNA: حمض polycytidylic (بولي (I: C)) في القوارض الحوامل قد استخدمت على نطاق واسع في نموذج حيواني لMIA 4،5. ومن المسلم: (C I) التي تشبه عدد مستقبلات 3 (TLR3)، والإدارة الشاملة للبولي (I: C) بولي يدفع الفيروسية مثل الاستجابة الالتهابية الحادة. واحدة من الآليات التي بولي (I: C) العلاقات العامةالعامة oduces تشوهات وneuropathologies السلوكية في النسل هي التي تسبب اختلالا السيتوكينات الالتهابية المؤيدة والمناهضة في محور الأم والمشيمة، الجنين 6. وقد تبنت عدة مجموعات نموذج MIA لفهم مسببات الاضطرابات النفسية ويرجع ذلك إلى المصالح المتنوعة بين المجموعات البحثية، وقد استخدمت نقاط زمنية مختلفة من تنشيط جهاز المناعة لتحقيق اضطرابات مختلفة على نمو الدماغ والسلوكيات 7.

المختبر بول ه باترسون في معهد كاليفورنيا للتكنولوجيا يتبنى استراتيجية حقن بولي (I: C) في الفئران الحوامل في الجنينية 12.5 يوما (E12.5)، الذي أثبت بنجاح أن وزارة الداخلية غير قادرة على إحداث السلوكية والعصبية، والتغيرات المناعية في النسل التي ترتبط مع مرض التوحد والفصام 8-11. تظهر أعمالنا السابقة التي MIA ذرية عرض الانحرافات السلوكية (على سبيل المثال، impairmen الاجتماعيةر، العجز الاتصالات، وتكرار السلوك، والسلوك للقلق مثل، والكامنة العجز تثبيط 8،10،12)، المناعي التقلبات والسيتوكينات الخلل 8،13،14، تغيير الجنين التعبير الجيني الدماغ 15، وفقدان الخلايا العصبية في فصيص السابع المخيخ 11، تغيير خصائص متشابك في قرن آمون جين العاشر بيئة التفاعل 13، تغيير نفاذية الأمعاء، والقناة الهضمية تكوين الجراثيم 16. وعلاوة على ذلك، يتم تطوير استراتيجيات علاجية وقائية أيضا من هذا 13،16،17 نظام نموذجي. عن طريق حفز MIA في E12.5، وقد أظهرت آخرون أن MIA تنتج تنشيط الجنين دبقية والتغيير التنموي الكوليني في الدماغ الأمامي القاعدية 18، سلالة معينة التفاعل 19، الدماغ الشلل synaptosomal تشوهات التركيبية، والشلل الميتوكوندريا التنفسي abnormalties سلسلة فرط الوظيفة، downregulation من جزيئات synaptosomal الدماغية 17 ،السلوكيات الاكتئاب مثل، وضعف في الإدراك وقرن آمون التقوية على المدى الطويل (الكمونية)، والعجز من البالغين الخلايا العصبية الحصين 20.

هنا، ونحن نقدم طريقة مفصلة لكيفية إحداث MIA في E12.5 التي كتبها بولي (I: C)، وكذلك نماذج لكيفية تطبيق هذا النموذج لدراسة مسببات مرض التوحد وانفصام الشخصية. ومن المهم الإشارة إلى أن وزارة الداخلية هو أحد عوامل الخطر لمجموعة متنوعة من الاضطرابات ونتائجها حساسة للغاية للوقت وطريقة الاستقراء وكذلك تربية السدود الحوامل. على هذا النحو، حتى التناقضات الثانوية بين المختبرات في كثير من الأحيان يؤدي إلى استنساخ منخفض و / أو الظواهر المختلفة في النسل. تم تصميم طريقة لدينا خصيصا للراغبين في دراسة MIA كعامل خطورة البيئي لمرض التوحد وانفصام الشخصية، وصفا مفصلا تقديمها سوف يساعد الباحثين على تحسين استنساخ البيانات الخاصة بهم.

Protocol

وأجريت جميع البروتوكولات بموجب موافقة من معهد كاليفورنيا للجنة رعاية واستخدام الحيوان المؤسسي التكنولوجيا (IACUC). 1. التحضير للأزواج موقوت التزاوج استخدام لا يقل عن 6 سدود للتجارب ?…

Representative Results

حقن 20 ملغ / كغ بولي (I: C) في E12.5 يمكن أن تثير استجابة التهابية حادة في محور الأم والمشيمة والجنين ويعجل له تأثير المزمن لنمو الدماغ والظواهر السلوكية 12،13. مستويات مرتفعة من proinflammatory سايتوكاين، انترلوكين (IL) -6، هو مؤشر موثوق من الاستجابة الالته?…

Discussion

MIA الحث على نوافذ زمنية مختلفة، يشوش الأحداث نمو المخ المختلفة في القوارض، وبالتالي يؤدي إلى تشوهات وneuropathologies سلوكية مختلفة في النسل. هنا، وصفنا بروتوكول للحث وزارة الداخلية في الفئران مع بولي (I: C) الحقن في E12.5. هذا الأسلوب من MIA تحريض يؤدي إلى السلوكية والعصبية، المن?…

Disclosures

The authors have nothing to disclose.

Acknowledgements

ونود أن تكريم الراحل الدكتور بول ه باترسون لإسهاماته في تقدم نموذج MIA، والتوحد، والبحوث الفصام. ونحن نعترف سركيس ك Mazmanian على دعمه الكبير على هذا البروتوكول. روبن م بايون، وإيفيت غارسيا فلوريس، كارين جيم Lencioni، وليزلي نيومان A. للحصول على المساعدة الإدارية؛ علي Khoshnan ويان جيم كو للمساعدة على تصوير. إلين Y. هسياو وناتاليا Malkova للحصول على المشورة على MIA الاستقراء. جيفري كوكرين، خواكين جوتيريز، كوان واو لي، خايمي رودريجيز، لورينا جيم ساندوفال، وناتالي A. فيردوزكو لتربية الحيوانات الخبراء الخاصة بهم. وأيد هذا العمل من قبل جائزة المعاهد الوطنية للصحة كونتي مركز (NIH 5P50MH086383-04، إلى بول ه باترسون)؛ التوحد يتحدث (# 7670، إلى بول ه باترسون)؛ مؤسسة سيمونز (# 322839، سركيس ك Mazmanian)؛ المعاهد الوطنية للصحة تدريب جرانت (NIH / NRSA T32GM07616 لك-HC)؛ معهد كاليفورنيا للتكنولوجيا الصيفية الجامعية زمالة أبحاث (SURF) (لZY)؛ أمجين برنامج المنح الدراسية في معهد كاليفورنيا للتكنولوجيا (لZY)؛ والاب زمالة بعد الدكتوراةمجلس أوم الوطنية للعلوم، تايوان (NSC 101-2917-I-564-039، إلى دبليو-LW).

Materials

Polyinosinic–polycytidylic acid potassium salt SIGMA P9582
0.9% sodium chloride INJ. USP HOSPIRA NDC 0409-4888-10
MONOJECT insuline syrinage 3/10 mL 29G x 1/2" COVIDIEN 8881600145
50 ml conical screw cap tubes USA SCIENTIFIC 1500-1211
Nanodrop 1000 spectrophotometer THERMO SCIENTIFIC 1000 Optional
Stereomicroscope Wild Heerbrugg M5A Optional
Dumont #5 Forceps Inox Tip Size .10 X .06mm Roboz RS-5045 Optional
RNAlater RNA stabilization reagent Qiagen 76104 Optional
TRIzol reagent Life Technologies 15596-026  Optional
RQ1 Rnase-free DNase Promega M610A Optional
iScript cDNA synthesis kit Bio-Rad 170-8891 Optional
FastStart universal SYBR green master mix with ROX  Roche 4913922001 Optional
Real-time PCR ABI 7300 Optional
Primer: Il6 forward Life Technologies TAGTCCTTCCTACCCCAATTTCC Optional
Primer: Il6 Reverse Life Technologies TTGGTCCTTAGCCACTCCTTC Optional
Primer: beta-actin forward Life Technologies AGAGGGAAATCGTGCGTGAC Optional
Primer: beta-actin Reverse Life Technologies CAATAGTGATGACCTGGCCGT Optional
MicroAmp optical 96-well reaction plate Life Technologies 4306737 Optionl
MicroAmp optical adhesive film  Life Technologies 4311971 Optionl
EthoVision Noldus EthoVision Optionl
SR-LAB apparatus (PPI) San Diego Instruments  SR-LAB Optionl
Marbles PENN-PLAX Blue gem stones marbles Optionl
Dulbecco's Phosphate-Buffered Saline (DPBS) Life Technologies 21600-069 Optionl
Paraformaldehyde MACRON 2621-59 Optionl
Vibratome Leica VT1000 S Optionl
Sodium azide Sigma S2002 Optionl
Triton x-100 Sigma X100 Optionl
Hydrogen peroxide solution Sigma 18312 Optionl
Goat serum Vector Laboratories S-1000 Optionl
Rabbit anti-calbindin antibody Abcam ab11426 Optionl
Biotinlyated goat anti-rabbit IgGantibody Vector Laboratories BA-1000 Optionl
VECTASTAIN ABC Kit Vector Laboratories PK-4000 Optionl

References

  1. Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
  2. Fatemi, S. H., et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
  3. Shi, L., Tu, N., Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
  4. Knuesel, I., et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
  5. Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
  6. Meyer, U., Feldon, J., Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
  7. Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
  8. Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
  9. Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
  10. Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
  11. Shi, L., et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
  12. Hsiao, E. Y., Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
  13. Wu, W. L., et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. , (2015).
  14. Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31, 54-68 (2013).
  15. Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2, e98 (2012).
  16. Hsiao, E. Y., et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
  17. Naviaux, R. K., et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
  18. Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
  19. Schwartzer, J. J., et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3, e240 (2013).
  20. Khan, D., et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4, e363 (2014).
  21. Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
  22. Abazyan, B., et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
  23. Meyer, U., et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
  24. Vuillermot, S., et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
  25. Bechard, A., Nicholson, A., Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
  26. Harvey, L., Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
check_url/53643?article_type=t

Play Video

Cite This Article
Chow, K., Yan, Z., Wu, W. Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C). J. Vis. Exp. (109), e53643, doi:10.3791/53643 (2016).

View Video