सिंगल वॉल कार्बन नैनोट्यूब (SWCNT) द्वारा Vivo में मल्टीपल मायलोमा सेल ग्रोथ का दमन-डिलीवर MALAT1 Antisense ओलिगोस्पर्मिया
Summary
इस पांडुलिपि एक एकल दीवार कार्बन नैनोट्यूब (SWCNT) के संश्लेषण का वर्णन-संयुग्मित MALAT1 antisense gapmer डीएनए oligonucleotide (SWCNT-anti-MALAT1), जो SWCNT के विश्वसनीय वितरण और शक्तिशाली उपचारात्मक प्रभाव को दर्शाता है एंटी MALAT1 इन विट्रो में और vivo में. संश्लेषण, संशोधन, विकार, और SWCNT-विरोधी MALAT1 के इंजेक्शन के लिए इस्तेमाल किया तरीकों का वर्णन कर रहे हैं ।
Abstract
सिंगल वॉल कार्बन नैनोट्यूब (SWCNT) एक नए प्रकार की nanoparticle है, जिसे कोशिकाओं में कई तरह की दवाओं को डिलीवर करने के लिए इस्तेमाल किया गया है, जैसे प्रोटीन, oligonucleotides, और सिंथेटिक छोटे-अणु ड्रग्स । SWCNT अनुकूलन आयामों, एक बड़े सतही क्षेत्र है, और flexibly अपनी सतह पर विभिंन संशोधनों के माध्यम से दवाओं के साथ बांध कर सकते हैं; इसलिए, यह कोशिकाओं में दवाओं के परिवहन के लिए एक आदर्श प्रणाली है । लंबे समय से कोडिंग RNAs (lncRNAs) के एक क्लस्टर कर रहे है decoding आरएनए से अधिक २०० nt, जो प्रोटीन के लिए अनुवाद नहीं किया जा सकता है लेकिन जैविक और pathophysiological प्रक्रियाओं में एक महत्वपूर्ण भूमिका निभाते हैं । मेटास्टेसिस-एसोसिएटेड फेफड़ों ग्रंथिकर्कटता प्रतिलिपि 1 (MALAT1) एक उच्च संरक्षित lncRNA है । यह प्रदर्शन किया गया था कि उच्च MALAT1 स्तर विभिन्न कैंसर के गरीब रोग का निदान करने के लिए संबंधित हैं, सहित कई मायलोमा (मिमी). हमें पता चला है कि MALAT1 डीएनए की मरंमत और मिमी में कोशिका मृत्यु को नियंत्रित करता है; इस प्रकार, MALAT1 मिमी के लिए एक चिकित्सीय लक्ष्य के रूप में माना जा सकता है । हालांकि, antisense oligo के कुशल प्रसव को रोकना/पछाड़ना MALAT1 vivo में अभी भी एक समस्या है । इस अध्ययन में, हम खूंटी-२००० के साथ SWCNT को संशोधित करने और इसे करने के लिए एक विरोधी MALAT1 oligo संयुग्मी, इन विट्रो में इस परिसर के वितरण का परीक्षण, यह नसों में एक प्रसार मिमी माउस मॉडल में सुई, और मिमी प्रगति का एक महत्वपूर्ण अवरोध का पालन, जो इंगित करता है कि SWCNT विरोधी MALAT1 gapmer डीएनए के लिए एक आदर्श प्रसव शटल है ।
Introduction
SWCNT एक उपंयास nanomaterial है कि दवाओं के विभिंन प्रकार के, जैसे प्रोटीन, छोटे अणुओं, और न्यूक्लिक एसिड के रूप में वितरित कर सकते हैं, छुरा और कुशलतापूर्वक आदर्श सहनशीलता और ंयूनतम विषाक्तता के साथ इन विट्रो में1 और vivo2में । एक कार्यात्मक SWCNT महान है असंगति और पानी घुलनशीलता, छोटे अणुओं के लिए एक शटल के रूप में इस्तेमाल किया जा सकता है, और उंहें ले जा सकते है करने के लिए सेल झिल्ली3,4,5घुसना ।
lncRNAs आरएनए के एक क्लस्टर (> 200 nt) कि जीनोम से mRNA के लिए लिखित रहे हैं, लेकिन प्रोटीन के लिए अनुवाद नहीं किया जा सकता है । सबूत बढ़ाने से पता चला है कि lncRNAs जीन अभिव्यक्ति6 के विनियमन में भाग लेते है और दीक्षा और कैंसर के अधिकांश प्रकार की प्रगति में शामिल हैं, मिमी7,8,9सहित । MALAT1 एक परमाणु-गैर कोडिंग प्रतिलिपि 2 (NEAT2) समृद्ध और एक उच्च संरक्षित lncRNA10है । MALAT1 शुरू में मेटास्टेटिक गैर छोटे सेल फेफड़ों के कैंसर (NSCLC)11में मांयता प्राप्त है, लेकिन कई ट्यूमर में व्यक्त किया गया है5,12,13; यह सबसे उच्च व्यक्त lncRNAs में से एक है और मिमी8,14में एक गरीब रोग का निदान के साथ संबंधित है । MALAT1 की अभिव्यक्ति स्तर पर गंभीर पाठ्यक्रम extramedullary mm रोगियों केवल मिमी15के रूप में निदान की तुलना में काफी अधिक है ।
पिछले एक अध्ययन में, हमने पुष्टि की है कि एंटी-MALAT1 ओलिगोस्पर्मिया मजबूती से डीएनए क्षति के लिए सीसा और mm16 में apoptosis gapmer डीएनए antisense oligonucleotides लक्ष्यीकरण MALAT1 (विरोधी MALAT1) का उपयोग करके मिमी कोशिकाओं में । gapmer डीएनए antisense डीएनए से बना है और 2 ‘ से जुड़े-OMe-RNAs, जो MALAT1 ज गतिविधि द्वारा त्वरित RNase दरार सकता है एक बार17बाध्य । में vivo वितरण दक्षता antisense ओलिगोस्पर्मिया अभी भी अपने नैदानिक उपयोग सीमा ।
एंटी-MALAT1 gapmer ओलिगोस्पर्मिया के लिए SWCNT के डिलिवरी प्रभाव का परीक्षण करने के लिए एंटी MALAT1 gapmer डीएनए को संयुग्मित-DSPE-अमीनी कार्यात्मकता PEG2000 है. SWCNT-विरोधी MALAT1 तो नसों में एक मिमी फैलाया माउस मॉडल में इंजेक्ट किया जाता है; एक हड़ताली निषेध चार उपचार के बाद मनाया जाता है ।
Protocol
Representative Results
Discussion
सबूत से पता चला है कि lncRNAs कैंसर में कई शारीरिक और pathophysiological प्रक्रियाओं के विनियमन में भाग लेने, मिमी सहित7,8,9; वे कैंसर के इलाज के लिए लक्षित होने की क्षमता है, जो antisense oligonucleotides<…
Disclosures
The authors have nothing to disclose.
Acknowledgements
लेखकों Lerner अनुसंधान संस्थान proteomic, जीनोमिक, और उनकी सहायता और समर्थन के लिए इमेजिंग कोर धंयवाद । फंडिंग: यह काम वित्तीय रूप से NIH/NCI ग्रांट R00 CA172292 (टू J.J.Z.) और स्टार्ट-अप फंड (J.J.Z. को) और केस वेस्टर्न रिजर्व यूनिवर्सिटी कोर उपयोग पायलट ग्रांट (CTSC) के नैदानिक और शोधों विज्ञान सहयोगी (J.J.Z.) द्वारा समर्थित था । यह काम Leica SP8 फोकल माइक्रोस्कोप कि स्वास्थ्य हस्ताक्षर अनुदान 1S10OD019972-01 के राष्ट्रीय संस्थानों से धन के साथ खरीदा गया था का उपयोग किया ।
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
