Förtryck av multipelt myelom celltillväxt In Vivo av enkel vägg nanorör (SWCNT)-levererade MALAT1 Antisense Oligos
Summary
Detta manuskript beskrivs syntesen av en enkel vägg nanorör (SWCNT)-konjugerat MALAT1 antisense gapmer DNA oligonukleotiden (SWCNT-anti-MALAT1), vilket visar SWCNT pålitlig leverans och den potenta terapeutiska effekten av anti-MALAT1 in vitro- och in vivo. Metoder som används för syntes, modifiering, konjugation, och injektion av SWCNT-anti-MALAT1 beskrivs.
Abstract
Den enkel vägg nanorör (SWCNT) är en ny typ av nanopartiklar, som har använts för att leverera flera typer av läkemedel in celler, till exempel proteiner, oligonukleotider och syntetiska småmolekylär droger. SWCNT har anpassningsbara dimensioner, en stor yta vid ytliga och flexibelt kan binda med droger genom olika modifieringar på dess yta. Därför är det ett idealiskt system att transportera narkotika in i celler. Långa icke-kodande RNAs (lncRNAs) är ett kluster av icke-kodande RNA längre än 200 nt, som inte kan översättas till protein men spelar en viktig roll i biologiska och patofysiologiska processer. Metastaser-associerade lunga adenokarcinom avskrift 1 (MALAT1) är en mycket lncRNA. Det visades att högre MALAT1 nivåer är relaterade till den dåliga prognosen av olika cancerformer, inklusive multipelt myelom (MM). Vi har visat att MALAT1 reglerar DNA reparation och cell död MM; MALAT1 kan således betraktas som ett terapeutiskt mål för MM. Effektiv leverans av den antisense oligo till hämma/knockdown MALAT1 in vivo är dock fortfarande ett problem. I denna studie vi ändra SWCNT med PEG-2000 och konjugat en anti-MALAT1 oligo till det, testa leveransen av denna förening in vitro-, injicera det intravenöst i en disseminerad MM musmodell och iaktta en signifikant hämning av MM progression, vilket indikerar det SWCNT är en perfekt leverans shuttle för anti-MALAT1 gapmer DNA.
Introduction
SWCNT är en roman nanomaterial som kan leverera olika typer av läkemedel, såsom proteiner, små molekyler och nukleinsyror, stabilt och effektivt med perfekt tolerabilitet och minsta toxicitet i vitro1 och invivo2. En functionalized SWCNT har utmärkt biokompatibilitet och vatten löslighet, kan användas som en transfer för mindre molekyler och kan bära dem för att penetrera cellmembranet3,4,5.
lncRNAs är ett kluster av RNA (> 200 nt) som transkriberas från genomet till mRNA men kan inte översättas till proteiner. Ökande bevis har visat att lncRNAs delta i regleringen av gen uttryck6 och är involverade i initiering och progression av de flesta typer av cancer, inklusive MM7,8,9. MALAT1 är en kärn-berikat kodande utskrift 2 (NEAT2) och en mycket lncRNA10. MALAT1 redovisas initialt i metastaserande icke-småcellig lung cancer (NSCLC)11, men har varit i ökad utsträckning i många tumörer5,12,13. Det är en av de mest högt uttryckt lncRNAs och korreleras med en dålig prognos i MM8,14. Uttrycket är MALAT1 betydligt högre i dödlig kurs extramedullär MM patienter jämfört med dem som endast diagnostiserats som MM15.
I en tidigare studie, vi har bekräftat att anti-MALAT1 oligos kraftfullt leda till DNA-skador och apoptos i MM16 med hjälp av gapmer DNA antisense oligonukleotider inriktning MALAT1 (anti-MALAT1) i MM celler. Gapmer DNA är sammansatt av antisense DNA och kopplat av 2′-OMe-RNAs, vilket kan snabba MALAT1 klyvning av RNase H aktivitet en gång bunden17. Invivo leverans effektiviteten i antisense oligos begränsar fortfarande dess kliniska användning.
För att testa leverans effekten av SWCNT för anti-MALAT1 gapmer oligos, den anti-MALAT1 gapmer DNA är konjugerat till DSPE-PEG2000-Amin functionalized SWCNT. Den SWCNT-anti-MALAT1 är sedan injiceras intravenöst i en MM disseminerad musmodell; en slående hämning observeras efter fyra behandlingar.
Protocol
Representative Results
Discussion
Fynd har visat att lncRNAs delta i regleringen av många fysiologiska och patofysiologiska förfaranden i cancer, inklusive MM7,8,9. de har potential att vara måltavlan för cancerbehandling, som kan förverkligas genom antisense oligonukleotider20,21,22. US Food and Drug Administration (FDA) har godkänt flera antisense oligonukleotid…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Författarna tacka Lerner Research Institute proteomiska, genomisk, och imaging kärnor för deras hjälp och stöd. Finansiering: Detta arbete stöddes ekonomiskt av NIH/NCI grant R00 CA172292 (till J.J.Z.) och nystartade fonder (till J.J.Z.) och klinisk och translationell vetenskap Collaborative (CTSC) fall Western Reserve University Core Utilization Pilot bidrag (till J.J.Z.). Detta arbete utnyttjas mikroskopet Leica SP8 confocal som köpts med finansiering från nationella institut för hälsa SIG grant 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
