Undertrykkelse af myelomatose cellevækst In Vivo af enkelt-væg kulstof nanorør (SWCNT)-leveres MALAT1 Antisense Oligos
Summary
Dette manuskript beskriver syntesen af en enkelt-væg kulstof nanorør (SWCNT)-konjugeret MALAT1 antisense gapmer DNA oligonukleotid (SWCNT-anti-MALAT1), som viser den pålidelig levering af SWCNT og den potent terapeutiske effekt af anti-MALAT1 in vitro og in vivo. Metoder anvendes til syntese, ændring, konjugering, og injektion af SWCNT-anti-MALAT1 er beskrevet.
Abstract
Enkelt-væg kulstof nanorør (SWCNT) er en ny type af nanopartikler, der er blevet brugt til at levere flere slags medicin ind i celler, såsom proteiner, oligonukleotider og små-molekyle designerdrugs. SWCNT har tilpasselig dimensioner, en stor overfladisk område, og kan fleksibelt binde med narkotika gennem forskellige ændringer på dens overflade; Derfor er det et ideelt system til transport af stoffer ind i celler. Længe noncoding RNA’er (lncRNAs) er en klynge af noncoding RNA længere end 200 nt, som ikke kan oversættes til protein, men spiller en vigtig rolle i biologiske og patofysiologiske processer. Metastase-associerede lunge adenocarcinom udskrift 1 (MALAT1) er en yderst velbevarede lncRNA. Det blev påvist, at højere MALAT1 niveauerne er relateret til den dårlig prognose af forskellige kræftformer, herunder myelomatose (MM). Vi har afsløret, at MALAT1 regulerer DNA reparation og celle død i MM; altså, MALAT1 kan betragtes som en terapeutisk destination for MM. Effektiv levering af antisense oligo at hæmme/knockdown MALAT1 in vivo er imidlertid stadig et problem. I denne undersøgelse, vi ændre SWCNT med PIND-2000 og konjugat en anti-MALAT1 oligo til det, teste levering af dette stof in vitro-, injicere det intravenøst i en dissemineret MM musen model og observere en betydelig hæmning af MM progression, som angiver at SWCNT er en ideel levering direkte til anti-MALAT1 gapmer DNA.
Introduction
SWCNT er en ny nanomateriale, der kan levere forskellige typer af lægemidler, såsom proteiner, små molekyler og nukleinsyrer, stabilt og effektivt med ideelle tolerabilitet og minimum toksicitet i vitro1 og in vivo2. En functionalized SWCNT har stor biokompatibilitet og vand opløselighed, kan bruges som en shuttle til mindre molekyler, og kan bære dem for at trænge ind i cellemembranen3,4,5.
lncRNAs er en klynge af RNA (> 200 nt) der er transskriberet fra genomet til mRNA men kan ikke omsættes til proteiner. Stadig flere beviser har vist at lncRNAs deltage i reguleringen af gen expression6 og er involveret i indledningen og progression af de fleste typer af kræft, herunder MM7,8,9. MALAT1 er en nuklear-beriget noncoding udskrift 2 (NEAT2) og en yderst velbevarede lncRNA10. MALAT1 er i første omgang anerkendt i metastatisk ikke-småcellet lungekræft (NSCLC) kræft11, men har været overexpressed i mange tumorer5,12,13; Det er en af de mest højt udtrykt lncRNAs og er korreleret med en dårlig prognose i MM8,14. Udtryk niveauet af MALAT1 er betydeligt højere i fatal kursus extramedullary MM patienter sammenlignet med dem kun diagnosticeret som MM15.
I en tidligere undersøgelse, har vi bekræftet, at anti-MALAT1 oligos håndfast fører til DNA-skader og apoptose i MM16 ved hjælp af gapmer DNA antisense oligonukleotider rettet mod MALAT1 (anti-MALAT1) i MM celler. Gapmer DNA er sammensat af antisense DNA og forbundet af 2′-OMe-RNA’er, som kunne bede MALAT1 spaltning af RNase H aktivitet en gang bundet17. In vivo levering effektiviteten af antisense oligos stadig begrænser dens kliniske anvendelse.
For at teste levering functionalized effekten af SWCNT til anti-MALAT1 gapmer oligos, anti-MALAT1 gapmer DNA er konjugeret til DSPE-PEG2000-Amin SWCNT. SWCNT-anti-MALAT1 derefter indsprøjtes intravenøst i en MM formidlet musen model; en slående hæmning er observeret efter fire behandlinger.
Protocol
Representative Results
Discussion
Beviser har vist, at lncRNAs at deltage i reguleringen af mange fysiologiske og patofysiologiske procedurer i kræftformer, herunder MM7,8,9; de har potentialet til at være målrettet til behandling af cancer, som kan realiseres af antisense oligonukleotider20,21,22. Den amerikanske Food and Drug Administration (FDA) har godkendt flere…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Forfatterne takke Lerner forskningsinstitut proteom, genomisk, og billedbehandling kerner for deres hjælp og støtte. Finansiering: Dette værk blev økonomisk støttet af NIH/NCI grant R00 CA172292 (til J.J.Z.) og start-up midler (til J.J.Z.) og klinisk og translationel Science Collaborative (CTSC) af Case Western Reserve University Core udnyttelse Pilot Grant (til J.J.Z.). Dette arbejde udnyttes Leica SP8 Konfokal mikroskop, som blev købt med støtte fra nationale institutter for sundhed SIGNA grant 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
References
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
