대장포에이성 줄기및 전구세포주에서 짧은 헤어핀 RNA 중재 유전자 녹다운에 의한 수지상 세포 개발 연구
Summary
여기서 우리는 체외 DC 분화에 대한 안정적인 녹다운 세포주를 얻기 위해 shRNA의 렌즈바이러스 트랜스듀션을 사용하여 수지상 세포(DC)의 개발에 관여하는 잠재적 전사 인자를 선별하기 위한 프로토콜을 제공합니다.
Abstract
수지상 세포 (DC)는 선천적이고 적응성 면역 반응을 연결하는 중요한 항원 제시 세포입니다. DC는 이질적이며 기존의 DC(cDC) 및 플라즈마 사이토이드 DC(pDC)로 나눌 수 있습니다. cDC는 순진한 T 세포를 위한 항원 제시를 전문으로 합니다. 한편, pDC는 바이러스 감염 시 다량의 타입 I 인터페론(IFN-I)을 생성할 수 있다. DC의 사양은 골수(BM)의 DC 전구체의 초기 단계에서 발생하며 전사 인자(TFs)의 네트워크에 의해 정의됩니다. 예를 들어, cDC는 높은 표현 ID2, PC는 높은 표현 E2-2 동안. 점점 더 많은 DC 하위 집합이 식별되고 있기 때문에 DC 개발을 제어하는 특정 TF를 이해하는 데 관심이 증가하고 있습니다. 여기서, 우리는 짧은 머리핀 RNA (shRNA)를 불멸의 조혈 줄기 및 선조 세포 (iHSPC) 라인으로 운반하는 렌즈 바이러스를 전달하여 시험관 내에서 DC 분화에 중요한 TFs를 선별하는 방법을 확립합니다. 안정적인 녹다운 세포 주 cDC 및 pDC 전위는 셀토메트리에 의해 분석된다. 이 접근은 시험관내선에서 선조에게서 DC 운명을 잠재적으로 지배하는 유전자를 확인하는 플랫폼을 제공합니다.
Introduction
DC는 선천적이고 적응형 면역의 주요 레귤레이터입니다1. DC는 주로 두 개의 기능적으로 구별되는 인구, 즉 pDC 및 cDC로 분류됩니다. 또한 cDC는 각각 I 형 및 유형 II cDC 또는 cDC1 및 cDC2의 두 개의 하위 집합을 포함합니다2. pDC, 발현 BST2, Siglec-H, 및 mice3,4에서 CD11c의 중간 수준은 염증 및 바이러스 감염 동안 많은 양의 IFN-I를 분비할 수 있는 세포입니다5. 그들의 강력한 IFN-I 생산 능력 때문에, 그(것)들은 또한 전신 루푸스 홍반성 (SLE)6를 포함하여 자기 면역 질병의 진행에 있는 중요한 역할을 하기 위하여 의심됩니다. cDC1s는 XCR1, CD8a, CLEC9A 및 CD103의 표면 발현에 의해 정의된 마우스7, 항원 교차 프레젠테이션을 통해 세포독성 CD8+ T 세포(CTL)의 활성화 및 편광에 전문화되어, 세포내 병원체 및 암에 대한 응답으로 I 면역을 시공한다. 한편, 인간과 마우스 모두에서 CD11b 및 CD172α(Sirpα라고도 함)를 발현하는 cDC2s는 CD4+ T 세포를 활성화하고 알레르겐 및 기생충에 대한 II형 면역 반응을 촉진할 수 있으며, 세포외 박테리아 및 미생물 인식에 따른 변조형 III 면역성을 11,12로 촉진할 수 있다.
DC의 다양화는 BM. E2-2(Tcf4에 의해 인코딩)에서 조혈 줄기 및 선조 세포(HSPC)로부터의 TF그룹에 의해 결정되며 pDC13,14의 분화 및 기능에 대한 마스터 레귤레이터이다. 대조적으로, DNA 결합 2(ID2)의 억제제는 cDC 사양을 구동하고 E 단백질 활성을 차단하여 pDC 개발을 억제한다15. 또한 cDC1의 개발은 IRF8 및 BATF3가 필요하며 cDC2의 차별화는 IRF416에 따라 다릅니다. 최근 작품은 pDC17및 cDC와 그들의 전사 규정18의 이질성을 탐구했다. DC 네트워크의 복잡성으로 인해 DC의 개발 및 기능을 제어하는 다른 TF를 식별할 수 있는 플랫폼을 구축해야 합니다.
여기서, 우리는 BM 세포에서 Hoxb8의 에스트로겐 조절 핵 전좌를 표현하여 생성된 iHSPC를 (Hoxb8-FL 세포라고도 함)를 사용했다 19. iHSPC는 β 에스트라디올과 Flt3 리간드(FL)가 있는 상황에서 차별화되지 않은 단계에 남아 있는 반면, β-estradiol19의 철수 시 FL의 존재속에서 다른 DC 유형으로 차별화하기 시작합니다. 이 기능을 바탕으로, 우리는 전조 단계에서 관심의 유전자를 노크 할 수 있습니다, 다음 PDC와 CDC의 체외 분화에 미치는 영향을 검사. 따라서, 이 방법은 DC의 발달 과 기능을 조절하는 유전자를 발견하는 강력한 도구이다.
Protocol
Representative Results
Discussion
Lentivirus 기반 shRNA 벡터는 종종 세포로 바이러스 성 변환에 의해 유전자 침묵에 사용되며 숙주 게놈으로 안정적인 통합을 허용합니다. 그러나, 상이한 세포 모형에 있는 각종 감과 효율을 고려해야 하고, 이 문제점을 극복하기 위하여 접근의 다수가 취해졌습니다.
폴리브레인은 세포막상에서 전하를 중화시킬 수 있는 다정화 폴리머로, 이를 통해 배관20 동안…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Tz-Ling Chen 박사의 기술 지원에 감사드립니다. 우리는 shRNA 렌즈바이러스 (http://rnai.genmed.sinica.edu.tw)를 제공하는 국립 RNAi 코어 시설 (학계 시니카, 대만)에 감사드립니다. 이 작품은 대만 과학기술부(대부분 108-2320-B-002-037-MY3 및 MOST 109-2320-B-002-002-054-MY3)에 의해 지원되었다.
Materials
| Antibodies | |||
| APC/Cy7 anti-mouse CD11c Antibody | Biolegend | 117324 | (Clone: N418) |
| FITC anti-mouse/human CD11b Antibody | Biolegend | 101206 | (Clone: M1/70) |
| PE anti-mouse/human B220 Antibody | Biolegend | 103208 | (Clone: RA3-6B2) |
| Cell culture | |||
| 1.5 mL Micro tube | ExtraGene | TUBE-170-C | |
| 12-well tissue culture-treated plate | Falcon | 353043 | |
| Fetal bovine serum (FBS) | Corning | 35-010-CV | |
| RPMI 1640 medium | gibco | 11875-085 | |
| Reagent | |||
| β-estradiol | Sigma-Aldrich | E2758-250MG | |
| β-mercaptoethanol (β-ME) | Sigma-Aldrich | M6250 | |
| FACS buffer | home-made | Formula: 1xPBS+0.5 %FBS+0.1%NaN3 | |
| Flt3 ligand (FL) | home-made | ||
| Polybrene | Sigma-Aldrich | TR-1003-G | |
| Puromycin | Invivogen | ant-pr-1 | |
| TRIsure | BIOLINE | BIO-38032 | |
| shRNA (Taregt sequence/clone ID) | Company | ||
| shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390) | The RNAi Consortium (TRC) | ||
| shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224) | The RNAi Consortium (TRC) | ||
| shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094) | The RNAi Consortium (TRC) | ||
References
- Steinman, R. M., Witmer, M. D. Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice. Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).
- Guilliams, M., et al. Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny. Nature Reviews Immunology. 14 (8), 571-578 (2014).
- Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12. Blood. 107 (6), 2474-2476 (2006).
- Swiecki, M., Colonna, M. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance. Immunology Reviews. 234 (1), 142-162 (2010).
- Liu, Y. -. J. IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annual Review of Immunology. 23 (1), 275-306 (2005).
- Panda, S. K., Kolbeck, R., Sanjuan, M. A. Plasmacytoid dendritic cells in autoimmunity. Current Opinion in Immunology. 44, 20-25 (2017).
- Durai, V., Murphy, K. M. Functions of murine dendritic cells. Immunity. 45 (4), 719-736 (2016).
- Mashayekhi, M., et al. CD8α(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites. Immunity. 35 (2), 249-259 (2011).
- Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. Genetic models of human and mouse dendritic cell development and function. Nature Reviews Immunology. 21 (2), 101-115 (2021).
- Plantinga, M., et al. Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen. Immunity. 38 (2), 322-335 (2013).
- Persson, E. K., et al. IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation. Immunity. 38 (5), 958-969 (2013).
- Kumamoto, Y., et al. CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity. Immunity. 39 (4), 733-743 (2013).
- Cisse, B., et al. Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development. Cell. 135 (1), 37-48 (2008).
- Grajkowska, L. T., et al. Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification. Immunity. 46 (1), 65-77 (2017).
- Jackson, J. T., et al. Id2 expression delineates differential checkpoints in the genetic program of CD8α+ and CD103+ dendritic cell lineages. The EMBO Journal. 30 (13), 2690-2704 (2011).
- Suzuki, S., et al. Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development. Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).
- Rodrigues, P. F., et al. Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells. Nature Immunology. 19 (7), 711-722 (2018).
- Brown, C. C., et al. Transcriptional basis of mouse and human dendritic cell heterogeneity. Cell. 179 (4), 846-863 (2019).
- Redecke, V., et al. Hematopoietic progenitor cell lines with myeloid and lymphoid potential. Nature Methods. 10 (8), 795-803 (2013).
- Abe, A., Miyanohara, A., Friedmann, T. Polybrene increases the efficiency of gene transfer by lipofection. Gene Therapy. 5 (5), 708-711 (1998).
- Sorgi, F. L., Bhattacharya, S., Huang, L. Protamine sulfate enhances lipid-mediated gene transfer. Gene Therapy. 4 (9), 961-968 (1997).
- Kirkling, M. E., et al. Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells. Cell Reports. 23 (12), 3658-3672 (2018).
- Pearce, E. J., Everts, B. Dendritic cell metabolism. Nature Reviews. Immunology. 15 (1), 18-29 (2015).
- Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. Metabolic Control of Dendritic Cell Functions: Digesting Information. Frontiers in Immunology. 10 (775), (2019).
- Saxton, R. A., Sabatini, D. M. mTOR signaling in growth, metabolism, and disease. Cell. 168 (6), 960-976 (2017).
