Here we present a protocol based on the mealworm (Tenebrio molitor)-bait system that was used for isolating and selecting entomopathogenic fungi (EPF) from soil samples. An effective conidia number (ECN) formula is used to select high stress tolerant EPF based on physiological characteristics for pest microbial control in the field.
Entomopathogenic fungi (EPF) are one of the microbial control agents for integrated pest management. To control local or invasive pests, it is important to isolate and select indigenous EPF. Therefore, the soil bait method combined with the insect bait (mealworm, Tenebrio molitor) system was used in this study with some modifications. The isolated EPF were then subjected to the virulence test against the agricultural pest Spodoptera litura. Furthermore, the potential EPF strains were subjected to morphological and molecular identifications. In addition, the conidia production and thermotolerance assay were performed for the promising EPF strains and compared; these data were further substituted into the formula of effective conidia number (ECN) for laboratory ranking. The soil bait-mealworm system and the ECN formula can be improved by replacing insect species and integrating more stress factors for the evaluation of commercialization and field application. This protocol provides a quick and efficient approach for EPF selection and will improve the research on biological control agents.
Currently, entomopathogenic fungi (EPF) are widely used in the microbial control of agricultural, forest, and horticultural pests. The advantages of EPF are its wide host ranges, good environmental adaptability, ecofriendly nature, and that it can be used with other chemicals to show the synergistic effect for integrated pest management1,2. For the application as a pest control agent, it is necessary to isolate a large number of EPF from either diseased insects or the natural environment.
The sampling of these organisms from their hosts helps in understanding the geographic distribution and prevalence rate of EPF in natural hosts3,4,5. However, the collection of fungal infected insects are usually limited by environmental factors and insect populations in the field4. Considering that insect hosts will die after EPF infection and then fall into the soil, isolation of EPF from soil samples might be a stable resource3,6. For example, saprophytes are known to use the dead host as their resource for growth. The soil bait and selective medium systems have been widely used to detect and isolate EPF from the soil3,4,7,8,9,10.
In the selective medium method, the diluted soil solution is plated onto a medium containing broad-spectrum antibiotics (e.g., chloramphenicol, tetracycline, or streptomycin) to inhibit the growth of bacteria2,3,9,11. However, it has been reported that this method may distort the strain's diversity and density and can cause an over- or under-estimation of many microbial communities6. Moreover, the isolated strains are less pathogenic and compete with saprophytes during isolation. It is difficult to isolate EPF from the diluted soil solution3. Instead of using a selective medium, the soil bait method isolates EPF from the infected dead insects, which can be stored for 2-3 weeks, thereby providing a more efficient and standard EPF separation method3,4,7,6. Because the method is easy to operate, one can isolate a variety of pathogenic strains at a low cost4. Therefore, it is widely used by many researchers.
Upon comparing the different types of insect bait systems, Beauveria bassiana and Metarhizium anisopliae are the most common EPF species that are found in insects belonging to the Hemiptera, Lepidoptera, Blattella, and Coleoptera6,12,13,14. Among these insect baits, Galleria mellonella (order Lepidoptera) and Tenebrio molitor (order Coleoptera) show higher recovery rates of Beauveria and Metarhizium spp., when compared with other insects. Therefore, G. mellonella and T. molitor are commonly used for insect baiting. Over the years, the United States Department of Agriculture (USDA) has established an EPF Library (Agricultural Research Service Collection of EPF cultures, ARSEF) that contains a wide variety of species, including 4081 species of Beauveria spp., 18 species of Clonostachys spp., 878 species of Cordyceps spp., 2473 species of Metarhizium spp., 226 species of Purpureocillium spp., and 13 species of Pochonia spp. among others15. Another EPF Library was constructed by the Entomology Research Laboratory (ERL) from the University of Vermont in the United States for c.a. 30 years. It includes 1345 strains of EPF from the United States, Europe, Asia, Africa, and the Middle East16.
To control local or invasion pests in Taiwan, isolation and selection of indigenous EPF is required. Therefore, in this protocol, we have modified and described the procedure of the soil bait method and combined it with the insect bait (mealworm, Tenebrio molitor) system17. Based on this protocol, an EPF library was established. Two rounds of screening (quantification of inoculation) were performed for the preliminary EPF isolates. EPF isolates showed pathogenicity to insects. The potential strains were subjected to morphological and molecular identifications and further analyzed by the thermotolerance and conidial production assay. Further, a concept of effective conidia number (ECN) was also proposed. Using ECN formula and principal component analysis (PCA), the potential strains were analyzed under simulated environmental pressure to complete the process of establishing and screening the EPF library. Subsequently, pathogenicity of promising EPF strains were tested for the target pest (e.g., Spodoptera litura). The current protocol integrates thermotolerance and conidial production data into the ECN formula and PCA analysis, which can be used as a standard ranking system for EPF related research.
NOTE: The whole flowchart is shown in Figure 1.
1. Isolation and selection of potential Entomopathogenic fungi (EPF)
2. Molecular identification of EPF
3. Morphological identification of EPF
4. Investigation of conidial productivity and thermotolerance
5. Effective conidia number (ECN) ranking
Isolation and selectionof potential Entomopathogenic fungi (EPF)
By using the Tenebrio molitor-mediated Entomopathogenic fungi (EPF) library construction method, the number of fungi without insect-killing activity would be excluded; thus, the isolation efficiency and selection of EPF could be largely increased. During the application of this method, the information of sampling sites, soil samples, and the fungal germination rates were recorded (Table 2). Based on our previous data, a total of 101 fungal isolates were obtained from 172 soil samples, indicating a high isolation efficiency of 64%. Among the 101 fungal isolates, 26 isolates showed insecticidal activity against T. molitor (100% mortality) after the 1st pathogenicity screening, hence the elimination of fungal isolates was 26/101 = 25.7%. In the 2nd virulence test, the high virulence of the 26 fungal isolates against T. molitor was further demonstrated, 12 of which showed high pathogenicity against the T. molitor larvae (100% mortality at 5 days post inoculation) (Figure 2A). These were used to evaluate the virulence test against the agricultural pest. Based on the data of the 3rd virulence test mortality and LT50, a total of six fungal isolates (NCHU-9, 11, 64, 69, 95, and 113) revealed rapid insect-killing activity against Spodoptera litura (LT50 = 2.94, 2.22, 2.84, 2.57, 2.96, and 1.13), assessed using the physiological assay and effective conidia number (ECN) (Figure 2B).
Molecular identification of EPF
To better understand the fungal taxonomic positions, 26 isolates from the 1st pathogenicity screening were subjected to molecular analysis based on the ITS region (Figure 3A). The result showed that these fungal isolates could be clearly divided into seven genera, including Beauveria, Clonostachys, Fusarium, Cordyceps, Penicillium, Purpureocillium, and Metarhizium (Figure 3A). Based on the ITS1-5.8S-ITS2 region, the genus classification of EPF was accurately confirmed, while the species level is still indistinguishable. Therefore, the sequence of the tef region is used to clearly classify the species level for 12 promising EPF isolates from the virulence test against the agricultural pest. The molecular identification of the 12 isolates showed that 11 isolates belong to Metarhizium and contained four species, including M. lepidiotae (NCHU-9, NCHU-102), M. pinghaense (NCHU-10, NCHU-11, NCHU-30, NCHU-32, NCHU-64), M. brunneum (NCHU-27, NCHU-29), and M. anisopliae (NCHU-69, NCHU-95). The remaining isolate was identified as B. australis (NCHU-113) (Figure 3B,C).According to the above result, the sequence region of tef can effectively distinguish the genus Metarhizium at species level, while other species need to find other sequence regions as molecular markers to distinguish the species.
Morphological identification of EPF
Through the cleaning method (step 3.2.3) of fungi morphological observations, the structures of conidiophores could be seen clearly with 0.1% Tween 80 solution (Figure 4A), and these observations could serve as a benchmark to measure the size of the structure and take a photo record. The color, shape, and arrangement of the conidia can be seen through microscopic observations of the colony conidia (Figure 4B,C). After observation, the sizes of conidia and conidiophore shapes could be further measured and statistically compared (Table 3).
Investigation of conidial productivity, thermotoleranceand ECN ranking
The ECN formula, which was proposed by the previous report21, could help with the selection of a high stress-tolerance EPF based physiological character. The ECN combines the conidia production and thermotolerance data of each EPF (Figure 5A,B), which means high viability of fungal strain when ECN value is high (Figure 5). Moreover, principal component analysis (PCA) visualization was used to verify the results from the ECN formula. The result revealed a high coordination between PCA and ECN, suggesting that the ECN formula could be used to evaluate the hierarchy of viability related parameters and development potential of fungi to field application and further commercialization (Figure 5C,D).
Figure 1: Illustration of Tenebrio molitor-mediated Entomopathogenic fungi (EPF) library construction. Part 1: Fungal isolation from soil sample; Part 2: Pathogenicity and virulence-based screening and fungal identification; Part 3. Physiological characterization and fungal ranking. ECN = Effective conidia number; and PCA = Principal component analysis. Please click here to view a larger version of this figure.
Figure 2: Mortality of mealworms and Spodoptera litura for selection of promising Entomopathogenic fungi (EPF) isolates. (A) 26-selected fungal 2nd mealworm virulence test; The mycoses of 12 rapid killing and high virulence fungal isolates are shown in parallel. (B) 12 fungal isolates were selected for virulence test against S. litura. Test on each fungal strain was repeated three times. d.p.i. = days post inoculation. Modified figure and legend reproduced with permission of the Fronteris21. Please click here to view a larger version of this figure.
Figure 3: The phylogenetic analysis of Entomopathogenic fungi (EPF) strains at (A) Genus-level based on ITS region and (B-C) Species-level based on tef. The phylogenetic analysis of ITS region and tef were constructed using the maximum likelihood (ML), minimum evolution (ME), and neighbor-joining (NJ) methods. Bootstrap analyses were performed to evaluate the robustness of the phylogenies using 1,000 replicates, and bootstrap proportions greater than 50% are indicated above branches. Bold = Ex-type strains. The red and green arrows indicate the promising EPF. Modified figure and legend reproduced with permission of the Fronteris21. Please click here to view a larger version of this figure.
Figure 4: Microscopic examination of Entomopathogenic fungi (EPF) (M. anisopliae) morphology. Observation of conidiophores (A) after washing. (B) The observation of conidia shape and color. (C) Arrangement of conidia and bundles of spore strings (SS) of M. anisopliae; Cp = conidiophores; cc = cylindrical conidia. Scale bar = 10 µm. Please click here to view a larger version of this figure.
Figure 5: Physiological characterization of six potential isolates and the effective conidia number (ECN) analysis. (A) Conidial production assay. (B) Thermotolerance assay. (C) The bar plot of ECN values. (D) Principal components analysis showed the distribution of each strain. Modified figure and legend reproduced with permission of the Fronteris21. Please click here to view a larger version of this figure.
Primer name | Amplicon Size (bp) | Sequence(5'-3') | Region | Reference | |
ITS1F | 550 | TCCGTAGGTGAACCTGCGG | ITS | 25 | |
ITS4R | TCCTCCGCTTATTGATATGC | ||||
tef-983F | 1000 | GCYCCYGGHCAYCGTGAYTTYAT | tef | 26, 27, 41, 42 | |
tef-2218R | ATGACACCRACRGCRACRGTYTG |
Table 1: Primer pairs for fungal identification.
Table 2: The parameters recorded for Tenebrio molitor-mediated EPF library construction method are listed below. NIU = the campus of National Ilan University. NCHU = the campus of National Chung Hsing University. Modified table and legend reproduced with permission of the Fronteris21. Please click here to download this Table.
Species | Strain | Phialides μm±SD* | Conidia μm±SD* |
Metarhizium lepidiotae | NCHU-9 | Cylindrical, 7.3±0.67b×2.4±0.36a | Cylindrical, 6.5±0.45a×2.7±0.13b |
Metarhizium pinghaense | NCHU-11 | Cylindrical, 8.6±0.68ab×2.6±0.30a | Cylindrical, 6.3±0.41b×2.7±0.16b |
Metarhizium pinghaense | NCHU-64 | Cylindrical, 10.5±1.54a×2.4±0.32a | Cylindrical, 6.8±0.53a×2.9±0.31a |
Metarhizium anisopliae | NCHU-69 | Cylindrical, 9.4±1.58a×2.7±0.32a | Cylindrical, 6.3±0.34b×2.6±0.19b |
Metarhizium anisopliae | NCHU-95 | Cylindrical, 9.6±0.87a×2.6±0.29a | Cylindrical, 6.0±0.82b×2.9±0.29a |
Beauveria australis | NCHU-113 | Ellipsoid, NA×2.6±0.57 | Globose, 2.3±0.24×2.3±0.24 |
*Statistical analysis was performed based on the Welch's ANOVA test by using R studio. | |||
§ Modified table and legend reproduced with permission of the Fronteris (23). |
Table 3: An example of morphological observations of six promising entomopathogenic fungal isolates. Statistical analysis was performed based on the Welch's ANOVA test by using R studio. Modified table and legend reproduced with permission of the Fronteris21.
Entomopathogenic fungi (EPF) have been used for insect control. There are several methods to isolate, select, and identify EPF30,31,32. Comparing the different types of insect bait methods, Beauveria bassiana and Metarhizium anisopliae were commonly found in insect baits6,12,13,14. Among these insect baits, Galleria mellonella and Tenebrio molitor showed high recovery rates of Beauveria and Metarhizium spp. As a matter of fact, the utility of the mealworm (T. molitor)-bait method was demonstrated as a convenience method for isolation of EPF from soil samples17,21. Nonetheless, it has been reported that used insects as bait would show the bias to isolate specific fungal species3,33. Therefore, combination of different insect species (i.e., Galleria mellonella and T. molitor together) to bait the EPF from the soil samples might increase the diversity of EPF34.
To evaluate the insect killing activity, there are two rounds of screening by mealworm (T. molitor) in the current protocol to select the promising fungal strains for further study. Following this process, the number of fungal isolates, which are isolated from soil samples, could be dramatically reduced and restricted to fungal isolates that showed high insecticidal activity after the 1st and 2nd screening. Large reduction of the fungal isolates for the next round of screening save time cost and labor-consuming. It could be also noted that the selected fungal isolates showed similar trends of pathogenicity between mealworm (T. molitor) and tobacco cutworm(Spodoptera litura), demonstrating a consistent testing of pathogenicity of different insect species and could be further extended to other crop pests21. In addition, the calculation of the ECN based on the physiological tests could facilitate the selection of potential fungal strains to be used in crop fields. Similar selective methods were mentioned by other reports, while the factors such as abiotic and strain characteristics have not been included12,8,31,35,36,37. Therefore, these strains may be affected by environmental factors resulting in an influence on the performance of fungal germination and thereby difficulty to be commercialized. This consequence is also the main reason for the inapplicability of laboratory strains in the field38.
From the morphological identification, further efforts should be directed toward finding the clear structure of conidiophore and observe the different characteristics of each fungal strain. Studies can include various methods for solving the difficult morphological identification39. However, the morphological identification fails to distinguish closely related fungal species; therefore, it is necessary to integrate the data of molecular identification. The internal transcribed spacer (ITS) region showed the genus level discrimination, while other molecular markers (i.e., tef for Metarhizium, bloc for Beauveria) are needed for the identification at the species level26,40,41.
In the physiological characterization, to reduce the standard deviation of the experiments, either the machine or manual vortex for at least 10 min at max rpm is suggested21. Thoroughly mixed conidia suspension would increase the consistency of the results of thermotolerance assay and conidial production assay. On the other hand, in the conidial production assay, the counted conidia number under a fixed area (5 mm block in the central part of fungal colony in this study) on the cultured plate at different time growth raised the problem that different fungal species and even different strains revealed different performance of the growth compactness of the hyphae, which might lead to the non-representativeness of the sampling. Therefore, a rigorous test method for conidia production can improve the problem, such as accurately count the number of conidia of whole fungal colony and normalize with the growth area42.
The effective conidia number (ECN) formula is designed based on the influence of environmental stress against EPF conidia, that is, simulate conidia under the condition of wild environment to select the promising fungal strains for commercialization21. In this protocol, the data of conidia production and heat treatment were used for the calculation of the total ECN value of each promising fungal strain, following the previous study21. Further, under a natural environment, except the temperature, other environmental stress, such as humidity, ultraviolet radiation (UV), and host could influence conidia germination. Especially, the UV stress is a main factor affecting conidia germination because the high-energy free radicals (such as peroxides, hydroxyl groups, and singlet oxygen) generated by UV may reduce pathogenicity and the persistence of microbial pesticides43. Thus, UV stress could be further included in the ECN formula in the future. To avoid UV stress, the formula should contain oil or sodium alginate to increase the UV tolerance of conidia44,45,46, which confirms that potential strains have practicality for pest control47.
The present protocol provided a method for quick and precise isolation of potential EPF strains to construct T. molitor-mediated EPF library. This is the basis and is necessary for the development of biological control research. Moreover, the ECN formula could be flexibly improved to help researchers grasp the potential of EPF and develop it into a commodity for use in agricultural systems.
The authors have nothing to disclose.
This research was supported by Grant 109-2313-B-005 -048 -MY3 from the Ministry of Science and Technology (MOST).
Agar Bacteriological grade | BIOMAN SCIENTIFIC Co., Ltd. | AGR001 | Suitable in most cell culture/molecular, biology applications. |
AGAROSE, Biotechnology Grade | BIOMAN SCIENTIFIC Co., Ltd. | AGA001 | For DNA electrophoresis. |
BioGreen Safe DNA Gel Buffer | BIOMAN | SDB001T | |
Brass cork borer | Dogger | D89A-44001 | |
Canon kiss x2 | Canon | EOS 450D | For record strain colony morphology |
Constant temperature incubator | Yihder Co., Ltd. | LE-509RD | Fungal keeping. |
cubee Mini-Centrifuge | GeneReach | MC-CUBEE | |
DigiGel 10 Digital Gel Image System | TOPBIO | DGIS-12S | |
Finnpipette F2 0.2 to 2 µL Pipette | Thermo Scientific | 4642010 | |
Finnpipette F2 1 to 10 µL Pipette | Thermo Scientific | 4642030 | |
Finnpipette F2 10 to 100 µL Pipette | Thermo Scientific | 4642070 | |
Finnpipette F2 100 to 1000 µL Pipette | Thermo Scientific | 4642090 | |
Finnpipette F2 2 to 20 µL Pipette | Thermo Scientific | 4642060 | |
Finnpipette F2 20 to 200 µL Pipette | Thermo Scientific | 4642080 | |
GeneAmp PCR System 9700 | Applied Biosystems | 4342718 | |
GenepHlow Gel/PCR Kit | Geneaid | DFH100 | |
Genius Dry Bath Incubator | Major Science | MD-01N | |
Graduated Cylinder Custom A 100mL | SIBATA | SABP-1195906 | Measure the volume of reagents. |
Hand tally counter | SDI | NO.1055 | |
Hemocytometer | bioman | AP-0650010 | Calculate the number of spore |
Inoculating loop | Dogger | D8GA-23000 | |
lid | IDEAHOUSE | RS92004 | |
Micro cover glass | MUTO PURE CHEMICALS CO.,LTD | 24241 | |
Microscope imaging system | SAGE VISION CO.,LTD | SGHD-3.6C | |
Microscope Slides | DOGGER | DG75001-07105 | |
Mupid-2plus DNA Gel Electrophoresis | ADVANCE | AD110 | |
Nikon optical microscope | SAGE VISION CO.,LTD | Eclipse CI-L | |
Plastic cup | IDEAHOUSE | CS60016 | |
Presto Mini gDNA Yeast Kit | Geneaid | GYBY300 | Fungal genomic DNA extraction kit |
Sabouraud Dextrose Broth (Sabouraud Liquid Medium) | HiMedia Leading BioSciences Company | M033 | Used for cultivation of yeasts, moulds and aciduric microorganisms. |
Scalpel Blade No.23 | Swann-Morton | 310 | |
Scalpel Handle No.4 | AGARWAL SURGICALS | SSS -FOR-01-91 | |
Shovel | Save & Safe | A -1580242 -00 | |
Silwet L-77 | bioman(phytotech) | S7777 | Surfactant |
Sorvall Legend Micro 17 Microcentrifuge | Thermo Scientific | 75002403 | |
Steel Tweezers | SIPEL ELECTRONIC SA | GG-SA | |
Sterile Petri Dish | BIOMAN SCIENTIFIC Co., Ltd. | 1621 | Shallow cylindrical containers with fitted lids, specifically for microbiology or cell culture use. |
ThermoCell MixingBlock | BIOER | MB-101 | |
Tween 80 | FUJIFILM Wako Pure Chemical Corporation | 164-21775 | |
TwinGuard ULT Freezer | Panasonic Healthcare Holdings Co., Ltd. | MDF-DU302VX | -80°C sample stored. |
Vertical floor type cabinet | Chih Chin | BSC-3 | Fungal operating culturing. |
Vortex Genie II | Scientific | SIG560 | |
Zipper storage bags | Save & Safe | A -1248915 -00 | |
100 bp DNA Ladder | Geneaid | DL007 | |
-20°C Freezer | FRIGIDAIRE | Frigidaire FFFU21M1QW | -20°C sample and experimental reagents stored. |
2X SuperRed PCR Master Mix | TOOLS | TE-SR01 | |
50X TAE Buffer | BIOMAN | TAE501000 |