In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG
Protocol
An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. There was a typo in Table 1. In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from: TTCTCATTGATGCTGAAGCC To: GAAACTAGTTATTTCCAACGG
Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. J. Vis. Exp. (145), e6311, doi: (2019).