JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Automatic Translation
Please note that all translations are automatically generated. Click here for the English version.
Biology

מדידה ישירה של כוחות בתוך צרורות מיקרוטובולים פעילים משוחזרים

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

כאן אנו מציגים פרוטוקול לשחזור צרורות מיקרוטובולים במבחנה וכימות ישיר של הכוחות המופעלים בתוכם באמצעות השמנה אופטית סימולטנית ומיקרוסקופיה פלואורסצנטית של השתקפות פנימית כוללת. בדיקה זו מאפשרת מדידה ברמה ננומטרית של הכוחות והתזוזות הנוצרים על ידי הרכבי חלבונים בתוך רשתות מיקרוטובולים פעילות.

Abstract

רשתות מיקרוטובולים משמשות בתאים כדי לבצע מגוון רחב של משימות, החל מפעולה כמסלולים להובלת שלפוחית ועד לעבודה כמערכים מיוחדים במהלך מיטוזה כדי לווסת את הפרדת הכרומוזומים. חלבונים המקיימים אינטראקציה עם מיקרוטובולים כוללים מנועים כגון קינסינים ודינאין, שיכולים ליצור כוחות פעילים ותנועה כיוונית, כמו גם חלבונים לא מוטוריים המקשרים חוטים לרשתות מסדר גבוה יותר או מווסתים את דינמיקת החוטים. עד כה, מחקרים ביופיזיים של חלבונים הקשורים למיקרוטובולים התמקדו באופן גורף בתפקידם של חלבונים מוטוריים בודדים הדרושים להובלת שלפוחית, והתקדמות משמעותית הושגה בהבהרת תכונות ייצור הכוח והוויסות המכנוכימי של קינסינים ודינינים. עם זאת, עבור תהליכים שבהם מיקרוטובולים פועלים הן כמטען והן כמסלול, כגון במהלך החלקת נימה בתוך הציר המיטוטי, הרבה פחות מובן על הרגולציה הביופיזית של הרכבים של חלבונים crosslinking המעורבים. כאן אנו מפרטים את המתודולוגיה שלנו לבדיקה ישירה של יצירת כוח ותגובה בתוך רשתות מינימליות של מיקרוטובולים מקושרים המשוחזרים ממיקרוטובולים מטוהרים וחלבונים מיטוטיים. זוגות מיקרוטובולים מוצלבים על ידי חלבונים בעלי עניין, מיקרוטובול אחד משותק לכיסוי מיקרוסקופ, והמיקרוטובול השני עובר מניפולציה על ידי מלכודת אופטית. מיקרוסקופיית פלואורסצנציה של השתקפות פנימית מלאה בו זמנית מאפשרת הדמיה רב-ערוצית של כל מרכיבי רשת מיקרוטובולים זו כאשר החוטים מחליקים זה מזה כדי ליצור כוח. אנו גם מדגימים כיצד ניתן להשתמש בטכניקות אלה כדי לחקור כוחות דחיפה המופעלים על ידי הרכבי קינסין-5 וכיצד כוחות בלימה צמיגים נוצרים בין זוגות מיקרוטובולים מחליקים המקושרים על ידי המפה המיטוטית PRC1. מבחנים אלה מספקים תובנות על המנגנונים של הרכבה ותפקוד צירים וניתן להתאים אותם באופן רחב יותר לחקר מכניקת רשת מיקרוטובולים צפופה בהקשרים מגוונים, כגון האקסון והדנדריטים של נוירונים ותאי אפיתל קוטביים.

Introduction

תאים משתמשים ברשתות מיקרוטובולים כדי לבצע מגוון רחב של משימות מכניות, החל מהובלת שלפוחית 1,2,3 ועד הפרדת כרומוזומים במהלך מיטוזה 4,5,6. רבים מהחלבונים המקיימים אינטראקציה עם מיקרוטובולים, כגון החלבונים המוטוריים המולקולריים קינזין ודינאין, מייצרים כוחות ומווסתים על ידי עומסים מכניים. כדי להבין טוב יותר כיצד מולקולות קריטיות אלה מתפקדות, חוקרים השתמשו בשיטות ביופיזיקליות של מולקולה בודדת, כגון השמנה אופטית ומיקרוסקופיית TIRF, כדי לנטר ישירות פרמטרים קריטיים כגון קצבי דריכה שנפרקו, תהליכי וקשרי כוח-מהירות עבור חלבונים בודדים. הגיאומטריה הניסויית הנפוצה ביותר הייתה הצמדת חלבונים מוטוריים ישירות ללכידת חרוזים שהגיאומטריה הכדורית שלהם וגודלם מחקים שלפוחיות העוברות תחבורה מונעת מנוע. קינסינים רבים, כולל קינזין-1 7,8,9, קינזין-2 10,11,12, קינזין-3 13,14,15,16 קינזין-517,18, קינזין-8 19,20, כמו גם קומפלקסים של דיינין ודיינין21,22, 23,24,25, נחקרו בשיטות אלה.

בתהליכים תאיים רבים, לעומת זאת, חלבונים מוטוריים ולא מוטוריים משתמשים במיקרוטובולים הן כמסלול והן כמטען26,27. יתר על כן, בתרחישים אלה שבהם חוטי מיקרוטובול מקושרים יחדיו לחבילות מסדר גבוה יותר, חלבונים אלה מתפקדים כהרכבים ולא כיחידות בודדות. לדוגמה, בתוך חלוקת תאים סומטיים, רשתות נימה צפופות מארגנות את עצמן כדי לבנות את מנגנון הציר המיטוטי28,29,30. רשת מיקרוטובול הציר הבין-קוטבי היא דינמית מאוד ומסודרת במידה רבה עם קצוות מינוס המצביעים לעבר קטבי הציר וקצוות פלוס החופפים ליד קו המשווה של הציר. חוטים בתוך הציר מוצלבים על ידי חלבונים מוטוריים כגון קינזין-5 31,32,33, קינסין-12 34,35,36, וקינזין-1437,38,39, או על ידי חלבונים לא מוטוריים כגון PRC1 40,41,42,43 או NuMA 44,45, 46. לעתים קרובות הם נעים או חווים לחץ מכני במהלך תהליכים כגון שטף הקוטב או תוך תיאום ריכוז הכרומוזומים במהלך מטאפאזה או הפרדת כרומוזומים במהלך אנאפאזה 47,48,49,50,51,52. שלמות מנגנון הציר בקנה מידה מיקרוני באמצעות מיטוזה, אם כן, מסתמכת על איזון מוסדר בקפידה של כוחות דחיפה ומשיכה שנוצרו ומתקיימים על ידי רשת זו של חוטים אינטראקציה. עם זאת, הכלים הדרושים כדי לחקור את הוויסות המכני הזה ולהסביר כיצד הרכבי חלבונים פועלים בתיאום כדי לתאם תנועות מיקרוטובולים ולייצר את הכוחות הדרושים להרכבה נכונה של הציר פותחו רק לאחרונה, ואנחנו רק מתחילים להבין את הכללים הביופיזיקליים שמגדירים רשתות מיקרוטובולים דינמיות.

מטרתו של כתב יד זה היא להדגים את הצעדים הנדרשים כדי ליצור מחדש זוגות מיקרוטובולים צולבים במבחנה, לשתק את הצרורות הללו בתא מיקרוסקופיה המאפשר הדמיה פלואורסצנטית סימולטנית הן של המיקרוטובולים והן של חלבונים צולבים ומדידת כוח בקנה מידה ננומטרי, ולעבד נתונים אלה בחוזקה. אנו מפרטים את השלבים הדרושים לפולימריזציה יציבה של מיקרוטובולים בעלי תווית פלואורסצנטית, הכנת כיסויי מיקרוסקופים לחיבור, הכנת חרוזי פוליסטירן לניסויים בלכידה אופטית, והרכבת רשתות נימה צולבות המשמרות את פונקציונליות ה- in vivo שלהם תוך מתן אפשרות למניפולציה ביופיזית ישירה.

Protocol

1. הכנת מיקרוטובולים הערה: כאשר משתמשים בחלבונים בעלי תווית GFP, אדומים (למשל, רודמין) ואדומים רחוקים (למשל, HiLyte647 שעברו ביוטינילציה, המכונים ביוטינילציה אדומה רחוקה בשאר הטקסט), תיוג פלואורופור אורגני של המיקרוטובולים פועל היטב. ניתן להשיג הצלבה מינימלית בין כל שלושת ?…

Representative Results

הכנת חבילות מיקרוטובול המתאימות לניתוח ביופיזי נחשבת מוצלחת אם מתקיימים כמה מהקריטריונים המרכזיים. ראשית, הדמיה בשלושה צבעים אמורה לחשוף שני מיקרוטובולים מיושרים עם ריכוז של חלבון crosslinking המקשט באופן מועדף את אזור החפיפה (איור 5B,C ואיור 6B</strong…

Discussion

רשתות מיקרוטובולים משמשות מספר עצום של סוגי תאים כדי לבצע מגוון רחב של משימות שהן מכניות במהותן. כדי לתאר כיצד תאים מתפקדים הן במצב בריא והן במצב של מחלות, חיוני להבין כיצד רשתות בקנה מידה מיקרוני אלה מאורגנות ומווסתות על-ידי חלבונים בגודל ננומטר שבונים אותן יחד. כלים ביופיזיקליים כגון פי?…

Disclosures

The authors have nothing to disclose.

Acknowledgements

המחברים מבקשים להודות על תמיכה מ- R21 AG067436 (ל- JP ו- SF), T32 AG057464 (ל- ET), ו- Rensselaer Polytechnic Institute School of Science Startup Funds (ל- SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

References

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. Biology. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. Biology. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image