דיפוזיה והרכבה של מולקולה בודדת על ממברנות שומנים עמוסות פולימרים
Summary
כאן מוצג פרוטוקול לביצוע וניתוח הקשירה, הניידות וההרכבה של מולקולות בודדות על ממברנות שומנים מלאכותיות צפופות באמצעות מיקרוסקופיה פלואורסצנטית של השתקפות פנימית כוללת של מולקולה אחת (smTIRF).
Abstract
ממברנות תאיות הן סביבות צפופות מאוד לתגובות ביומולקולריות ולאיתותים. עם זאת, רוב הניסויים במבחנה החוקרים אינטראקציה של חלבונים עם שומנים משתמשים בממברנות דו-שכבתיות עירומות. מערכות כאלה חסרות את המורכבות של צפיפות על ידי חלבונים וגליקנים המוטמעים בממברנה ואינן כוללות את השפעות הנפח הנלוות על פני השטח של קרום התא. כמו כן, משטח הזכוכית הטעון שלילית שעליו נוצרים דו-שכבתי השומנים מונע דיפוזיה חופשית של ביומולקולות טרנסממברנות. כאן אנו מציגים ממברנה פולימרית-שופתית המאופיינת היטב כחיקוי של ממברנות שומנים צפופות. פרוטוקול זה משתמש בשומנים מצומדים מפוליאתילן גליקול (PEG) כגישה כללית לשילוב קראודרים בשכבת השומנים הנתמכת (SLB). ראשית, מוצג הליך ניקוי של השקופיות והכיסויים המיקרוסקופיים לביצוע ניסויים במולקולה בודדת. לאחר מכן, נדונו שיטות לאפיון PEG-SLBs וביצוע ניסויים של מולקולות בודדות של קשירה, דיפוזיה והרכבה של ביומולקולות באמצעות מעקב אחר מולקולות בודדות ופוטו-הלבנה. לבסוף, פרוטוקול זה מדגים כיצד לנטר את מכלול הננו-נקבוביות של רעלן יוצר נקבוביות חיידקים ציטוליזין A (ClyA) על ממברנות שומנים צפופות באמצעות ניתוח פוטו-לבנה של מולקולה אחת. קודי MATLAB עם מערכי נתונים לדוגמה כלולים גם כדי לבצע חלק מהניתוחים הנפוצים כגון מעקב אחר חלקיקים, חילוץ התנהגות מפוזרת וספירת תת-יחידות.
Introduction
קרומי התאים הם מערכות צפופות ומורכבות מאוד1. לצפיפות מולקולרית יכולה להיות השפעה ניכרת על דיפוזיה של ישויות הקשורות לממברנה כמו חלבונים ושומנים 2,3,4. באופן דומה, תגובות דו-מולקולריות על ממברנות שומניות כמו דימריזציה של קולטנים או אוליגומריזציה של קומפלקסים של ממברנות מושפעות מצפיפותשל 5,6,7. האופי, התצורה והריכוז של ה-crowders יכולים לשלוט בקשירת הממברנה, בדיפוזיביות ובאינטראקציה בין חלבון לחלבון בכמה דרכים 8,9. מאחר שקשה לשלוט בצפיפות הממברנות התאי ולפרש את השפעתן על ביומולקולות משובצות, חוקרים ניסו ליצור מערכות חוץ גופיות חלופיות 10.
גישה פופולרית עבור ממברנות צפופות מלאכותיות היא סימום הממברנות הדו-שכבתיות בפולימר (כגון פוליאתילן גליקול, PEG) – שומנים מושתלים11,12. במהלך הדמיה של דינמיקה של חלבונים ושומנים על דו-שכבתיות שומנים נתמכות (SLBs), פולימרים אלה גם מגנים על הרכיבים המוטבעים בממברנה מפני המצע הטעון שלילית הבסיסי (כגון זכוכית) על ידי הרמה יעילה של הדו-שכבה הרחק מהתמיכה הבסיסית. על ידי שינוי הגודל והריכוז של הפולימר, ניתן לשלוט במידת הצפיפות המולקולרית, כמו גם בהפרדתו מהתמיכה המוצקההבסיסית 13,14. זהו ללא ספק יתרון על פני דו-מולקולות של שומנים הנתמכים על מצעים מוצקים ללא כריות פולימריות15,16, שבהן ביומולקולות טרנס-ממברנה יכולות לאבד את פעילותן17,18,19. חשוב מכך, הוא מאפשר לנו לשחזר את הסביבה הצפופה של קרום התא במבחנה, שהיא קריטית לתהליכי ממברנה רבים.
פולימרים המושתלים על פני השטח על ממברנות עוברים גם שינויים בתצורתם בהתאם לצפיפות ההשתלהשלהם 12. בריכוזים נמוכים, הם נשארים בתצורה מפותלת אנטרופית, המכונה פטריה, מעל פני הממברנה. עם הריכוז הגובר, הם מתחילים לקיים אינטראקציה ונוטים להתפרק ולהתרחב, ולבסוף מניבים היווצרות צפופה דמוית מברשת על הממברנה21. מכיוון שהמעבר מפטרייה למשטר המברשת הוא הטרוגני מאוד ומתבטא בתנאים לא מאופיינים היטב של הפולימר, חשוב להשתמש בתנאים מאופיינים היטב לצפיפות על ממברנות מושתלות בפולימר. בהשוואה למחקרשנערך לאחרונה 20, אנו מזהים ומדווחים על הרכבי ממברנות צפופים השומרים על ההובלה והפעילות הדיפוזית של ביומולקולות טרנסממברניות.
בפרוטוקול זה אנו דנים כיצד ליצור ממברנות שומנים PEGylated ומספקים המלצות לציפותי PEG המחקים צפיפות בשני משטרים שונים של תצורת פולימרים (כלומר, פטריות ומברשת). הפרוטוקול מתאר גם קשירה של מולקולה בודדת, מעקב אחר חלקיקים ואיסוף וניתוח נתוני פוטו-הלבנה עבור מולקולות המוטבעות בממברנות צפופות אלה. ראשית, אנו מתארים את שלבי הניקוי היסודי, את הרכבת תא ההדמיה ואת יצירת PEG-SLBs. שנית, אנו מספקים פרטים לניסויים של קשירת מולקולה בודדת, מעקב אחר חלקיקים ופוטו-הלבנה. שלישית, נדון ב-א) חילוץ זיקות הקשירה היחסיות, ב) אפיון הדיפוזיה המולקולרית, ו-ג) ספירת תת-יחידות במכלול חלבונים מסרטים של מולקולות בודדות על הממברנה.
בעוד שאפיינו את המערכת הזו בהדמיה של מולקולה בודדת, הפרוטוקול שימושי לכל הביופיזיקאים של הממברנות המעוניינים להבין את השפעת הצפיפות על תגובות ביומולקולריות על ממברנות שוממניות. בסך הכל, אנו מציגים צינור חזק לייצור דו-שכבתיות שומנים צפופות ונתמכות, יחד עם בדיקות שונות של מולקולות בודדות הנערכות עליהם ושגרות הניתוח המתאימות.
Protocol
Representative Results
Discussion
כאן אנו מדגימים ניסויים של מולקולות בודדות על דו-מולקולות נתמכות של שומנים (SLBs) שמפגינים סביבה צפופה עבור ביומולקולות משובצות ממברנה. הסביבה הצפופה יוצרת אפקט נפח מוחרג, המוביל לשיפור התגובות הביומולקולריות 1,2,39,40. עבו?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
המחברים מודים לפרופ’ בנימין שולר על שיתוף הביטוי פלסמיד לחלבון ClyA. עבודה זו נתמכה על ידי תוכנית המדע של הגבול האנושי (RGP0047-2020).
Materials
| 2.5 ml Syringes | HMD Healthcare | Dispo Van, 2.5 ml Tuberculin | Plastic syringe |
| Acetone | Finar Chemicals | 10020LL025 | |
| Acrylic Sheet | 2 mm thick | ||
| Acrylic Sheet | BigiMall | 2 mm, Clear | |
| Bath Sonicator | Branson | CPX-1800 | |
| Calcium Chloride | |||
| Chloroform | Sigma | 528730 | HPLC grade |
| Cholesterol | Avanti | 700100 | |
| Coplin Jar | Duran Wheaton Kimble | S6016 | 8 Slide Jar with Glass Cover |
| Coverslips | VWR | 631-1574 | 24 mm X 50 mm |
| Cy3-DNA Strand | IDT | GCTGCTATTGCGTCCGTTTGGTT GGTGTGGTTGG-Cy3 |
|
| Cyanine Dye (Cy3) | Cytiva Life Sciences | PA23001 | |
| DiI | Invitrogen | D3911 | Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3))) |
| DNA Connector Strand 1 | Sigma Aldrich | GCTGCTATTGCGTCCGTTTAGCT GGGGGAGTATTGCGGAGGAAGC T |
|
| DNA Connector Strand 2 | Sigma Aldrich | CGGACGCAATAGCAGCTCACAG TCGGTCACAT |
|
| DNA Tocopherol Strand | Biomers | Toco-CCCAATGTGACCGACTGTGA | |
| DOPE-PEG2000 | Avanti | 880130 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) |
| Double Sided Tape | 3M | LF93010LE | |
| Drill Bits (Diamond Coated) | 0.5 – 1 mm | ||
| Drilling Machine | Dremel | 220 | Workstation |
| EMCCD | Andor | DU-897U-CS0-#BV | |
| Fluorescence Beads | Invitrogen | F10720 | |
| Glass Slides | Blue Star | Micro Slides, PIC-1 | |
| Glass Vials | Sigma | 854190 | |
| Hydrogen Peroxide | Lobachemie | 00182 | 30% Solution, AR Grade |
| Labolene | Thermo-Fischer Scientific | Detergent | |
| Laser 532 nm | Coherent | Sapphire | |
| Laser Cutter | Universal Laser Systems | ILS12.75 | |
| Lissamine Rhodamine DOPE | Avanti | 810150 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt) |
| Methanol | Finar Chemicals | 30932LL025 | |
| Microscope | Olympus | IX81 | |
| Phosphate Buffer Saline (PBS) | 1X | ||
| Plasma Cleaner | Harrick Plasma Inc | PDC-002 | |
| POPC | Avanti | 850457 | 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine |
| Programmable Syringe Pump | New Era Pump Systems | NE1010 | High Pressure Syringe Pump |
| PTFE Caps | Sigma | 27141 | |
| PTFE Tubing | Cole-Parmer | WW-06417-21 | Masterflex, 0.022" ID x 0.042" OD |
| Sulphuric Acid | SD Fine Chemicals | 98%, AR Grade | |
| TIRF Objective | Olympus | UPLAPO100XOHR | |
| Vacuum Desiccator | Tarsons | ||
| Vortex Mixer | Tarsons |
References
- Löwe, M., Kalacheva, M., Boersma, A. J., Kedrov, A. The more the merrier: Effects of macromolecular crowding on the structure and dynamics of biological membranes. The FEBS Journal. 287 (23), 5039-5067 (2020).
- Kuznetsova, I. M., Turoverov, K. K., Uversky, V. N. What macromolecular crowding can do to a protein. International Journal of Molecular Sciences. 15 (12), 23090-23140 (2014).
- Horton, M. R., Höfling, F., Rädler, J. O., Franosch, T. Development of anomalous diffusion among crowding proteins. Soft Matter. 6 (12), 2648-2656 (2010).
- Jeon, J. H., Javanainen, M., Martinez-Seara, H., Metzler, R., Vattulainen, I. Protein crowding in lipid bilayers gives rise to non-Gaussian anomalous lateral diffusion of phospholipids and proteins. Physical Review X. 6 (2), 021006 (2016).
- Zhang, Y., et al. The influence of molecular reach and diffusivity on the efficacy of membrane-confined reactions. Biophysical Journal. 117 (7), 1189-1201 (2019).
- Loverdo, C., Bénichou, O., Moreau, M., Voituriez, R. Enhanced reaction kinetics in biological cells. Nature Physics. 4 (2), 134-137 (2008).
- Monine, M. I., Haugh, J. M. Reactions on cell membranes: Comparison of continuum theory and Brownian dynamics simulations. Journal of Chemical Physics. 123 (7), 074908 (2005).
- Berry, H. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes. Physical Review E. 89 (2), 22708 (2014).
- Saxton, M. J. Anomalous diffusion due to obstacles: A Monte Carlo study. Biophysical Journal. 66 (2), 394-401 (1994).
- Andersson, J., Fuller, M. A., Wood, K., Holt, S. A., Köper, I. A tethered bilayer lipid membrane that mimics microbial membranes. Physical Chemistry Chemical Physics. 20 (18), 12958-12969 (2018).
- Kaufmann, S., Papastavrou, G., Kumar, K., Textor, M., Reimhult, E. A detailed investigation of the formation kinetics and layer structure of poly(ethylene glycol) tether supported lipid bilayers. Soft Matter. 5 (14), 2804-2814 (2009).
- Marsh, D., Bartucci, R., Sportelli, L. Lipid membranes with grafted polymers: Physicochemical aspects. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1615 (1-2), 33-59 (2003).
- Labouta, H. I., et al. Surface-grafted polyethylene glycol conformation impacts the transport of PEG-functionalized liposomes through a tumour extracellular matrix model. RSC Advances. 8 (14), 7697-7708 (2018).
- Lee, H., Larson, R. G. Adsorption of plasma proteins onto PEGylated lipid bilayers: The effect of PEG size and grafting density. Biomacromolecules. 17 (5), 1757-1765 (2016).
- Richter, R. P., Bérat, R., Brisson, A. R. Formation of solid-supported lipid bilayers: An integrated view. Langmuir. 22 (8), 3497-3505 (2006).
- Andersson, J., et al. Solid-supported lipid bilayers – A versatile tool for the structural and functional characterization of membrane proteins. Methods. 180, 56-68 (2020).
- Duncan, A. L., et al. Protein crowding and lipid complexity influence the nanoscale dynamic organization of ion channels in cell membranes. Scientific Reports. 7 (1), 1-15 (2017).
- Garenne, D., Libchaber, A., Noireaux, V. Membrane molecular crowding enhances MreB polymerization to shape synthetic cells from spheres to rods. Proceedings of the National Academy of Sciences of the United States of America. 117 (4), 1902-1909 (2020).
- Pollock, N. L., Lee, S. C., Patel, J. H., Gulamhussein, A. A., Rothnie, A. J. Structure and function of membrane proteins encapsulated in a polymer-bound lipid bilayer. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1860 (4), 809-817 (2018).
- Coker, H. L. E., et al. Controlling anomalous diffusion in lipid membranes. Biophysical Journal. 116 (6), 1085-1094 (2019).
- Rex, S., Zuckermann, M. J., Lafleur, M., Silvius, J. R. Experimental and Monte Carlo simulation studies of the thermodynamics of polyethyleneglycol chains grafted to lipid bilayers. Biophysical Journal. 75 (6), 2900-2914 (1998).
- Hallett, F. R., Watton, J., Krygsman, P. Vesicle sizing number distributions by dynamic light scattering. Biophysical Journal. 59 (2), 357-362 (1991).
- Jin, A. J., Huster, D., Gawrisch, K., Nossal, R. Light scattering characterization of extruded lipid vesicles. European Biophysics Journal. 28 (3), 187-199 (1999).
- Axelrod, D. Chapter 7: Total internal reflection fluorescence microscopy. Methods in Cell Biology. 89, 169-221 (2008).
- Fish, K. N. Total internal reflection fluorescence (TIRF) microscopy. Current Protocols in Cytometry. 50 (1), 1-13 (2009).
- Fiolka, R., Belyaev, Y., Ewers, H., Stemmer, A. Even illumination in total internal reflection fluorescence microscopy using laser light. Microscopy Research and Technique. 71 (1), 45-50 (2008).
- Roy, R., Hohng, S., Ha, T. A practical guide to single-molecule FRET. Nature Methods. 5 (6), 507-516 (2008).
- Jaqaman, K., et al. Robust single-particle tracking in live-cell time-lapse sequences. Nature Methods. 5 (8), 695-702 (2008).
- Tinevez, J. Y., et al. TrackMate: An open and extensible platform for single-particle tracking. Methods. 115, 80-90 (2017).
- Jarmoskaite, I., Alsadhan, I., Vaidyanathan, P. P., Herschlag, D. How to measure and evaluate binding affinities. eLife. 9, 57264 (2020).
- Sathyanarayana, P., et al. Cholesterol promotes Cytolysin A activity by stabilizing the intermediates during pore formation. Proceedings of the National Academy of Sciences of the United States of America. 115 (31), 7323-7330 (2018).
- Mueller, M., Grauschopf, U., Maier, T., Glockshuber, R., Ban, N. The structure of a cytolytic alpha-helical toxin pore reveals its assembly mechanism. Nature. 459 (7247), 726-730 (2009).
- Hubicka, K., Janczura, J. Time-dependent classification of protein diffusion types: A statistical detection of mean-squared-displacement exponent transitions. Physical Review E. 101 (2), 1-13 (2020).
- Kepten, E., Weron, A., Sikora, G., Burnecki, K., Garini, Y. Guidelines for the fitting of anomalous diffusion mean square displacement graphs from single particle tracking experiments. PLoS ONE. 10 (2), 0117722 (2015).
- Persson, F., Lindén, M., Unoson, C., Elf, J. Extracting intracellular diffusive states and transition rates from single-molecule tracking data. Nature Methods. 10 (3), 265-269 (2013).
- McGuire, H., Aurousseau, M. R. P., Bowie, D., Blunck, R. Automating single subunit counting of membrane proteins in mammalian cells. The Journal of Biological Chemistry. 287 (43), 35912-35921 (2012).
- Hines, K. E. Inferring subunit stoichiometry from single molecule photobleaching. The Journal of General Physiology. 141 (6), 737-746 (2013).
- Zhang, H., Guo, P. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation. Methods. 67 (2), 169-176 (2014).
- Phillip, Y., Schreiber, G. Formation of protein complexes in crowded environments-From in vitro to in vivo. FEBS Letters. 587 (8), 1046-1052 (2013).
- Mittal, S., Chowhan, R. K., Singh, L. R. Macromolecular crowding: Macromolecules friend or foe. Biochimica et Biophysica Acta – General Subjects. 1850 (9), 1822-1831 (2015).
- Mashaghi, S., van Oijen, A. M. A versatile approach to the generation of fluid supported lipid bilayers and its applications. Biotechnology and Bioengineering. 111 (10), 2076-2081 (2014).
- Wong, W. C., et al. Characterization of single-protein dynamics in polymer-cushioned lipid bilayers derived from cell plasma membranes. The Journal of Physical Chemistry B. 123 (30), 6492-6504 (2019).
- Shashkova, S. S., Leake, M. C. Single-molecule fluorescence microscopy review: Shedding new light on old problems. Bioscience Reports. 37 (4), 20170031 (2017).
- Ishikawa-Ankerhold, H. C., Ankerhold, R., Drummen, G. P. C. Advanced fluorescence microscopy techniques-FRAP, FLIP, FLAP, FRET and FLIM. Molecules. 17 (4), 4047 (2012).
- Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
- Carter, B. C., Vershinin, M., Gross, S. P. A comparison of step-detection methods: How well can you do. Biophysical Journal. 94 (1), 306-319 (2008).
- Otsuka, S., Ellenberg, J. Mechanisms of nuclear pore complex assembly – Two different ways of building one molecular machine. FEBS Letters. 592 (4), 475 (2018).
- Tsekouras, K., Custer, T. C., Jashnsaz, H., Walter, N. G., Pressé, S. A novel method to accurately locate and count large numbers of steps by photobleaching. Molecular Biology of the Cell. 27 (22), 3601-3615 (2016).
- Bryan, J. S., Sgouralis, I., Pressé, S. Enumerating high numbers of fluorophores from photobleaching experiments: A Bayesian nonparametrics approach. bioRxiv. , (2020).
- Bryan, J. S., Sgouralis, I., Pressé, S. Diffraction-limited molecular cluster quantification with Bayesian nonparametrics. Nature Computational Science. 2 (2), 102-111 (2022).
- Kim, Y., et al. Efficient site-specific labeling of proteins via cysteines. Bioconjugate Chemistry. 19 (3), 786-791 (2008).
