Using Cleavage Under Targets and Tagmentation (CUT&Tag) Assay in Mouse Myoblast Research

Summary

Researchers new to the epigenetic field will find CUT&Tag a significantly easier alternative to ChIP assays. CUT&Tag has tremendously benefited the epigenetic studies on rare and primary cell populations, generating high-quality data from very few cells. This protocol describes performing H3K4me1 CUT&Tag assays on mouse myoblasts isolated from mouse hindlimb muscles.

Abstract

This protocol paper aims to provide the new researchers with the full details of using Cleavage Under Targets and Tagmentation (CUT&Tag) to profile the genomic locations of chromatin binding factors, histone marks, and histone variants. CUT&Tag protocols function very well with mouse myoblasts and freshly isolated muscle stem cells (MuSCs). They can easily be applied to many other cell types as long as the cells can be immobilized by Concanavalin-A beads. Compared to CUT&Tag, chromatin immunoprecipitation (ChIP) assays are time-consuming experiments. ChIP assays require the pre-treatment of chromatin before the chromatic material can be used for immunoprecipitation. In cross-linking ChIP (X-ChIP), pre-treatment of chromatin involves cross-linking and sonication to fragment the chromatin. In the case of native ChIP (N-ChIP), the fragmented chromatins are normally achieved by Micrococcal nuclease (MNase) digestion. Both sonication and MNase digestion introduce some bias to the ChIP experiments. CUT&Tag assays can be finished within fewer steps and require much fewer cells compared to ChIPs but provide more unbiased information on transcription factors or histone marks at various genomic locations. CUT&Tag can function with as few as 5,000 cells. Due to its higher sensitivity and lower background signal than ChIPs, researchers can expect to obtain reliable peak data from merely several millions of reads after sequencing.

Introduction

CUT&Tag assay was invented to compensate for some overt flaws of ChIPs¹. The two major disadvantages of ChIPs are 1) the bias introduced when fragmenting chromatin and 2) the incompetence to work with low cell numbers. X-ChIP assays rely on either sonication or MNase digestion to get chromatin fragments, whereas N-ChIP mostly uses MNase digestion to get nucleosomes. Sonication shows a bias towards relaxed chromatin locations such as promoter regions², and apparently, MNase digestion also works more efficiently on relaxed chromatin fibers. Moreover, some reported that MNase digestion also shows a DNA sequence-dependent bias³. Therefore, at the input preparation step of ChIP assays, it is impossible to get chromatin fragments from all kinds of genomic locations in a perfectly random manner. Moreover, ChIP assays normally generate higher background signals compared to CUT&Tag and require over 10 folds more reads than CUT&Tag to accentuate where the peaks are^1,4,5. This explains why ChIP experiments have to start with tremendously more cells than CUT&Tag. This is not a problem when studying cell lines as they can be repetitively passaged to achieve a very high cell number. However, the ChIP assay is definitely not a strong epigenetic tool to study rare or precious primary cell populations, although primary cells obviously hold more practical and medical implications.

While the long and complicated ChIP procedure discourages some researchers from learning or using this technique, people are more comfortable with easier assays such as immunocytochemistry (ICC) or immunofluorescence (IF). A CUT&Tag assay essentially resembles the process of ICC and IF experiments but only takes place in a test tube. CUT&Tag does not need fragmented chromatin to start with, and instead, the genome must be intact for antibody binding¹. On the first day of a ChIP experiment, researchers normally spend up to 4 h preparing the fragmented chromatins from nuclei with sonication or MNase digestion before the short chromatin pieces can be mixed with antibody-beads^4,5. In remarkable contrast, the first-day workload of a CUT&Tag procedure is to just immobilize the cells to Concanavalin-A beads and then to add the primary antibody onto the cell-beads. This only requires ~40 min¹.

It is worth mentioning that Cleavage Under Targets and Release Using Nuclease (CUT&RUN) is an important alternative to CUT&Tag. CUT&RUN was established based on a similar working mechanism as CUT&Tag. In CUT&Tag, the antibodies guide the pA/G-Tn5 transposase to all the locations where the enzyme will each cut out a piece of chromatin and meanwhile tag it with library-making adaptors, while in CUT&RUN, the role of pA/G-Tn5 is played by the pA/G-MNase which only performs the cutting part of the job⁶. Therefore, compared to CUT&Tag, CUT&RUN requires an additional step which is to glue the library-making adaptors onto the pA/G-MNase-fragmented DNA pieces^7,8. Due to the high similarities between CUT&Tag and CUT&RUN, researchers familiar with CUT&Tag will easily adapt themselves to performing CUT&RUN proficiently. However, it should be noted that some minor differences exist between CUT&Tag and CUT&RUN. CUT&RUN protocols normally use the physical concentration of salt (~150 mM) in the washing steps, while in CUT&Tag, the 300-Dig wash buffer is high in salt. Therefore, CUT&Tag is good at controlling the background when profiling histone marks/variants or transcription factors, as these proteins directly and strongly bind DNA¹. CUT&Tag may run into problems when profiling chromatin-associated factors that do not directly bind DNA and show weak affinity to the chromatin. High salt washing steps in CUT&Tag may strip off chromatin-associated factors and cause no signals in the final output. Although there are successful cases where CUT&Tag can be used to profile some non-histone/non-transcription factor proteins⁹, we still recommend CUT&RUN over CUT&Tag to profile weakly-bound chromatin-associated proteins.

After mammals reach adulthood, their skeletal muscle tissues still contain muscle stem cells. During muscle injury, these stem cells can be activated and undergo cell number expansion and differentiation to regenerate damaged muscle fibers¹⁰. These stem cells are known as Muscle stem/satellite cells (MuSCs). After MuSCs are isolated from animals or once activated by muscle injury, they start proliferating and become myoblasts.

To obtain MuSCs from mouse skeletal muscle digest, MuSC surface markers such as Vcam1 (Cd106), Cd34, and α7-integrin (Itga7) are often used individually or in combinations to enrich MuSCs during fluorescence-activated cell sorting (FACS)¹¹. It has been shown that Cd31^-/Cd45^-/Sca1^-/Vcam1⁺ is probably the best marker combination to get >95% pure MuSCs¹². FACS can isolate pure MuSCs right after fresh muscles are digested. However, if the experimental design does not require pure MuSCs right at their isolation, pre-plating is more cost-effective than FACS to obtain >90% pure myoblasts (MuSC progeny).

MuSCs freshly isolated from mice do not proliferate efficiently in Ham's F10 media supplemented with fetal bovine serum (FBS). To better expand the cell number of MuSCs and get sufficient myoblasts, bovine growth serum (BGS) should be used instead of FBS. However, if BGS is not available, Ham's F10 full media (containing about 20% FBS) can be mixed with an equal volume of T-cell conditional media to dramatically promote myoblast expansion¹³. Therefore, this protocol will also describe the preparation of T-cell media conditioned MuSC media.

Most importantly, this protocol provides a complete example of performing H3K4me1 CUT&Tag assays on mouse myoblasts isolated from mouse hindlimb muscles. Please note that this protocol also applies to other cell types and histone marks and histone variants, and readers only need to optimize the cell numbers or antibody amounts for their cases based on the enrichment of the specific histone marks or variants they study.

In order to be used in CUT&Tag or CUT&RUN, the Tn5 or MNase needs to be fused with protein A or protein G to make pA-Tn5, pG-Tn5, pA-MNase, or pG-MNase. Apparently, both protein A and protein G can be fused onto these enzymes at the same time to generate pA/G-Tn5 or pA/G-MNase. Protein A and protein G show differential affinities to IgGs from different species. Therefore, fusing protein A and protein G altogether onto the enzyme can overcome this problem and make the enzyme compatible with antibodies from multiple species.

Protocol

The methods presented in this manuscript are all approved by the Institutional Animal Care and Use Committee of Guangzhou Laboratory. Mice used to generate this manuscript's representative results were housed and maintained in accordance with the guidelines of the Institutional Animal Care and Use Committee of Guangzhou Laboratory.

1. Myoblast isolation from mouse hindlimb muscles (Example of using 1 mouse)

1. Dilute glacial acetic acid with ddH₂O to 0.02 M and autoclave it.
2. Dilute collagen (from rat tail) to 0.1 mg/mL with 0.02 M acetic acid.
3. Add this collagen solution into culture dishes to coat the dish bottom in a 37 °C cell incubator for overnight.
4. Before use, remove the collagen solution and wash the dish twice with 1x PBS. Collagen solution can be reused for 8-10 times.
5. Sacrifice an 8-12-week-old mouse. (Old mice have poor yields of MuSCs and myoblasts.)
6. Isolate and place all hindlimb muscles from the mouse into a 10-cm dish.
7. Use 1x PBS (with penicillin/streptomycin) to rinse the muscles 4 times. After each rinse, always transfer the muscles into a new plate.
8. After the final rinse, remove PBS and mince up the muscles with scissors.
9. Add 6 mL of 1x PBS containing dispase II (1.1 U/mL) and collagenase II (830 U/mL) to digest the minced muscles, and the digestion should last for ~1.5 h.
10. To perform digestion, transfer the minced muscles into a tube in a 37 °C water bath or directly leave the minced muscles within the dish and place it in a 37 °C CO₂ cell incubator.
11. If using a cell incubator to digest, rock the dish every 15-30 min to mix the digestion well.
    NOTE: Dispase II should be first made as 11 U/mL stock with DMEM media (no serum), and collagenase II should be made as 10,000 U/mL stock with 1x PBS.
12. When the digestion is complete, use a 10-mL plastic pipet to flush the digested tissues up and down several times to homogenize the digestion mixture thoroughly.
13. Add 10 mL of MuSC/Myoblast growth media to slow down the digestion. Details on the preparation of MuSC/Myoblast growth media can be found in Section 2.
14. Run the mixture through a 70-µm strainer. Use 1x PBS to rinse the digestion plate and run this PBS through the strainer as well, in order to collect all the cells in the digestion plate.
15. Centrifuge at 350 x g for 10 min and discard the supernatant with vacuum.
16. Resuspend the cell pellet with 20 mL of 1x PBS and run the cells through a 40-µm strainer.
17. Centrifuge at 350 x g for 5 min and remove the supernatant with vacuum.
18. Use 20 mL of MuSC/Myoblast growth media to resuspend the cells and seed the cells in a 10-cm normal plastic plate. MuSCs cannot attach to the plate bottom during this time and will stay floating mostly in the media.
    NOTE: This is the first pre-plating on plastic plates.
19. After 1.5 h, briefly rock the plate and transfer the liquid into two collagen-coated 10-cm dishes, each dish containing 10 mL of culture. Now, the MuSCs will attach and grow on the collagen-coated plates. Change the media after 2 days. Collagen-coated plates are prepared as in steps 1-4 of this section.
20. After another day, passage the cells: Remove the media, wash the cells once with 1x PBS, and trypsinize the cells.
21. Use MuSC/Myoblast growth media to flush the cells off the plates, move the cells onto a new plastic plate, and incubate in the cell incubator for 40 min.
    NOTE: This is the second pre-plating on plastic plates.
22. Pour the culture into a new plastic plate and incubate in the cell incubator for another 20 min.
    NOTE: This is the third pre-plating on plastic plates.
23. Then split the supernatant in the plate into 8 collagen-coated 10-cm dishes to subculture the cells. The passage ratio here is 2: 8 (1: 4). After three times of pre-plating described above, the myoblasts can reach over 90% pure. Therefore, after this point, there is no need to pre-plate when further passaging the myoblasts.

2. Preparation of MuSC/Myoblast growth media (Example of preparing from 5 mice)

1. Sacrifice 5 young and healthy wild-type mice, isolate the spleens, and rinse the spleens once with 1x PBS (with penicillin/streptomycin).
2. Use scissors to remove the dark parts/spots on the spleens, if any. Discard the spleen if most of it has turned black.
3. Place all 5 spleens into a 40-µm strainer on the top of a 50 mL tube.
4. Open a sterile 1 mL syringe package, pull out the plunger, and discard the barrel.
5. In the 40-µm strainer, hold the rubber stopper and use the thumb rest of the plunger to grind and disassociate the spleen tissues into single cells. Be careful not to touch and contaminate the thumb rest of the plunger when tearing open the syringe package.
6. While grinding the spleens, occasionally use 1x PBS to wash off the dissociated spleen cells into the 50 mL tube underneath the strainer.
7. After all the spleen cells have been flushed into the 50 mL tube through the strainer, centrifuge the tube at 500 x g for 10 min.
8. Use 1 mL of 1x Red blood cell lysis buffer to resuspend the pellet. Lyse the red blood cells for ~1 min.
   NOTE: 10x Red blood cell lysis buffer contains 155 mM NH₄Cl, 10 mM NaHCO₃, and 1 mM EDTA disodium salt in ddH₂O. Filter to sterilize, and do not autoclave. Dilute with ddH₂O to 1x before use.
9. Fill up the 50 mL tube with 1x PBS to cease the lysing process of red blood cells.
10. Strain the cell suspension again with a 40-µm strainer, and then centrifuge at 500 x g for 10 min.
11. Resuspend the cells with 2 mL of RPMI-1640 full media (RPMI-1640 media with 10% FBS and penicillin/streptomycin) with very gentle pipetting.
12. Add more RPMI-1640 full media into the tube and mix well. Distribute the cell suspension into ten T75 culture flasks. The final culture volume in each T75 culture flask should be 20 mL.
13. Add 10 µL of Concanavalin-A stock into each T75 culture flask and mix well. Concanavalin-A activates the proliferation of T-cells.
    NOTE: Concanavalin-A stock is 4 mg/mL and prepared by dissolving Concanavalin-A in 1x PBS. The Concanavalin-A itself is used here, and do not confuse it with the Concanavalin-A beads used in CUT&Tag assays later on.
14. After 48 h, supplement each T75 flask with another 20 mL of RPMI-1640 full media so the total volume will add up to 40 mL.
15. Another 24 h later, collect all the culture in each T75 flask and centrifuge at 600 x g for 3 min.
16. The supernatant is T-cell conditional media and can be stored at -20 °C to -80 °C for up to 2 months. Discard the spleen cell pellets. Before use, thaw the T-cell conditional media and further sterilize the media using a 0.22 µm filter.
17. To make Ham's F10 full media, add 100 mL of FBS, 300 µL of bFGF stock, and 6 mL of penicillin/streptomycin into 500 mL of Ham's F10 media.
    NOTE: bFGF stock is 5 µg/mL and prepared by dissolving bFGF in Ham's F10 media.
18. Mix the Ham's F10 full media with filtered T-cell conditional media described above at 1:1 ratio to make MuSC/Myoblast growth media.

3. CUT&Tag with myoblasts (Example of 3 CUT&Tag reactions)

1. Preparation of key reagents
   1. Purify the pA/G-Tn5 transposase in-house from bacterial culture using published method¹⁴. This enzyme only reaches its functional form till it is mounted with library-making DNA adaptors. Most importantly, pA/G-Tn5 is commercially available from many sources.
   2. The oligos to make adaptors are shown in Table 1. Specifically, anneal Oligo-Rev with Oligo-A and Oligo-B, respectively, to make double-stranded Adaptor-A and Adaptor-B accordingly. The details for annealing to make the adaptors can be found elsewhere¹⁴.
   3. Incubate Adaptor-A and Adaptor-B with pA/G-Tn5 transposase at room temperature (RT) for 2 h. Then, this transposase will take its functional form. In the following sections of this manuscript, the functional form of pA/G-Tn5 will be termed pA/G-Tn5a.
      NOTE: If the pA/G-Tn5 is purchased instead of in-house made, make sure to clarify whether the bought item is pA/G-Tn5 mounted with adaptors (in other words, ready to use) or it is just the pA/G-Tn5 enzyme itself. If it is just the enzyme, prepare the two adaptors described above and mount them onto the pA/G-Tn5 before finally using this enzyme for CUT&Tag.
   4. For the recipes of the Binding buffer, Wash buffer, Dig-wash buffer, 300-Dig buffer, and Tagmentation buffer, readers can also refer to Kaya-Okur et al.¹.
   5. Prepare the Binding buffer, which contains 20 mM HEPES pH 7.5, 10 mM KCl, 1 mM CaCl₂, and 1 mM MnCl₂.
   6. Prepare the Wash buffer, which contains 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, and 1x Protease inhibitor cocktail.
   7. Make digitonin as a concentrated stock in DMSO, and then prepare Dig-wash buffer by adding digitonin into Wash buffer to a concentration of 0.5 mg/mL.
   8. Prepare Antibody buffer by adding EDTA to a concentration of 2 mM and BSA to a concentration of 0.1%, into the Dig-wash buffer.
   9. Prepare 300-Dig buffer containing 20 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM Spermidine, 1x Protease inhibitor cocktail, and 0.1-0.5 mg/mL digitonin.
   10. Prepare the Tagmentation buffer by supplementing the 300-Dig buffer with 10 mM MgCl₂. MgCl₂ can activate the enzymatic activity of pA/G-Tn5a.
       NOTE: Information for other materials is provided in the Table of Materials file.
2. Concanavalin-A bead activation
   1. Mix 30 µL of Concanavalin-A beads (10 µL for each reaction) into 300 µL of Binding buffer in a 1.5 mL centrifuge tube. Invert several times to mix well. Put the tube onto a magnetic rack. After the liquid is clear, remove the supernatant.
   2. Remove the tube from the magnetic rack, add 300 µL of Binding buffer in the tube, mix well, and evenly split into 3 tubes of an 8-PCR tube stripe. Designate each tube with one CUT&Tag reaction.
   3. Put the 8-PCR tube stripe on a magnetic rack and wait till the liquid is clear.
   4. Aspirate the supernatant and remove the tubes from the magnetic rack. Add 10 µL of Binding buffer into each tube and mix well. Place the prepared beads on ice or at 4 °C till the cells are ready to proceed.
3. Binding cells onto Concanavalin-A beads
   1. Trypsinize cultured mouse myoblasts off the plates, wash the cells once with RT 1x PBS and eventually resuspend the cells in Wash buffer at RT. Avoid over-trypsinization, as this can compromise the affinity of the cell membrane to Concanavalin-A beads.
   2. Adjust the cell density to around 7 x 10⁵ cells/mL in Wash buffer such that 100 µL of cell suspension contains roughly 70,000 cells, sufficient for one CUT&Tag reaction.
   3. Pipet 100 µL of the cell suspension into each tube of the 8-PCR tube stripe, which already contains 10 µL of prepared Concanavalin-A beads. Mix well and incubate on a "seesaw motion" shaker for 10 min at RT.
   4. Put the 8-PCR tube stripe on a magnetic rack. Wait till it clears, and remove the supernatant.
   5. To assess whether the Concanavalin-A beads have efficiently sequestered the cells, check the supernatant under a microscope to see how many cells are left in the supernatant. After the Concanavalin-A bead binding step, very few or no cells should be observed in the supernatant.
4. Incubating the cells with a primary antibody
   1. For each sample, dilute 1 µL of H3K4me1 antibody into 50 µL of Antibody buffer and add the diluted antibody into each sample tube. Mix the beads well with the diluted antibody by inverting the tubes several times. Put the samples on the "seesaw motion" shaker to incubate at 4 °C for overnight.
      NOTE: As mentioned by Dr. Steven Henikoff¹, it was not necessary to use an IgG negative control in all CUT&Tag assays. Compared to ChIPs, CUT&Tag assays come with much lower or no background signal. Therefore, using IgG to perform a "negative control" CUT&Tag assay does not introduce any useful information. In contrast, using a CUT&Tag-validated antibody to perform a positive control is important to assess whether the CUT&Tag assay has worked.
5. Incubating the cells with a secondary antibody
   1. The next day morning, put the samples on the magnetic rack and wait till the samples clear.
   2. Remove the supernatant, which is the primary antibody. There is no need to wash the beads; Directly add 50 µL of diluted (1:100) secondary antibody into each sample tube.
      NOTE: Secondary antibody is diluted with Dig-wash buffer at a 1:100 ratio. To allow more efficient pA/G-Tn5a recognition, secondary antibodies should not be conjugated with any molecules or groups such as HRP, biotin, or fluorophores.
   3. Mix well and incubate on the "seesaw motion" shaker at RT for 1 h.
   4. Put the samples back on the magnetic rack, wait till the samples clear, and discard the supernatant.
   5. Add 200 µL of Dig-wash buffer into each tube and invert several times to wash off the excessive antibodies.
   6. Put it back on the magnetic rack, wait till it clears, and remove the supernatant. Repeat this washing twice more to completely remove excessive unbound antibodies.
6. Incubating the cells with pA/G-Tn5a
   1. After the last wash, put the samples on the magnetic rack, wait till the samples clear, and remove all the liquid in the tube. For each sample tube, add 100 µL of 300-Dig buffer containing pA/G-Tn5a at 0.04 µM. Mix well and incubate on the seesaw motion shaker for 1 h at RT.
   2. Put on the magnetic rack. Wait till the samples clear and remove the supernatant.
   3. Add 200 µL of 300-Dig buffer into each sample, mix well, and place on the shaker to wash the sample for 3 min at RT.
   4. Put on the magnetic rack. Wait till the samples clear and remove the supernatant. Repeat this washing twice more to remove excessive pA/G-Tn5a and lower the background.
7. Cleavage and tagmentation of the genomes
   1. After the last wash, put the samples on the magnetic rack and thoroughly pipet the liquid off the tube. For each sample, add 50 µL of Tagmentation buffer. Mix well and incubate in a PCR machine at 37 °C for 1 h. Do not use the lid-heating function of the PCR machine.
      NOTE: Optionally, due to the material wearing during the following genomic DNA purification step, some spike-in DNAs can be added into the Tagmentation buffer so that the spike-in will show up in the final sequencing results and can be used to normalize the data. The method for preparing and using the spike-in DNA can be found elsewhere¹⁴.
8. Total genomic DNA purification
   1. After tagmentation, add another 150 µL of Tagmentation buffer for each sample. The total volume is now 200 µL.
   2. Then, for each sample, add 10 µL of 0.5 M EDTA, 3 µL of 10% SDS, and 2.5 µL of 20 mg/mL Proteinase K. Vortex to mix well and incubate at 55^°C for 2 h.
   3. Pipet each sample into 200 µL of phenol/chloroform in a 1.5 mL centrifuge tube and vortex for 10 s. Centrifuge at 18,000 x g for 5 min. Transfer the top layer into a new 1.5 mL centrifuge tube.
   4. Add 200 µL of chloroform into each tube and vortex for 10 s. Centrifuge at 18,000 x g for 5 min.
   5. Aspirate the top layer into a new 1.5 mL centrifuge tube. Then, for each sample, add 550 µL of 100% ethanol to precipitate the DNA at -80 °C for 1 h. To better visualize the DNA pellet, add 1 µL of 20 mg/mL glycogen.
   6. Centrifuge at max speed (>18,000 x g) for 15 min to pellet the DNA.
   7. Carefully pour off the supernatant, wash the glycogen/DNA pellet with 75% ethanol once, and centrifuge again at max speed for 5 min.
   8. Remove the 75% ethanol and resuspend the glycogen/DNA pellet with 21 µL of ddH₂O.
9. Library preparation and sequencing
   1. Set up the library-preparing PCR. To index the samples to be sequenced together, use a different N7XX Illumina primer for each sample and a universal N5XX Illumina primer. If indexing more than 12 samples, then different N5XX Illumina primers will be required as well. Illumina provides twelve N7XX primers and eight N5XX primers, so the total number of N7XX with N5XX combinations is 12 x 8 = 96. The PCR reaction setup is shown in Table 2.
   2. Roughly determine the PCR cycle number in library-preparing PCR by the cell number used in the CUT&Tag assay. Normally, for a CUT&Tag assay using 50,000-100,000 cells, 9-12 cycles are quite sufficient, and cell numbers between 10,000-50,000 might require up to 14 cycles. The PCR program is displayed in Table 3.
      NOTE: For most CUT&Tag assays, if the antibody has functioned properly, then a PCR cycle number between 9-14 should always generate a useful library for sequencing. A good library is normally 10-50 ng/µL (determined by Qubit assay) in concentration and 20-30 µL in volume. On the contrary, if the antibody did not work efficiently and specifically, then merely increasing the cycle number cannot save the experiments. Excessive cycle numbers do not benefit the results at all and instead introduce more PCR duplicates, which will later complicate the data analysis.
   3. Use some commercially available DNA purification/size-selection beads to purify the library DNA and select the DNA of desirable sizes.
   4. Dilute a small aliquot of the purified library with water and use it for qPCR with locus-specific primers to check enrichments as in ChIP-qPCR experiments. Before sequencing the library, this can help determine whether the CUT&Tag has worked.
   5. Perform sequencing and data analysis as per the manufacturer's instructions.
      NOTE: CUT&Tag kits are commercially available from a handful of companies, and one example can be found in the Table of Materials file.

Representative Results

Before binding cells to Concanavalin-A beads, check the cell suspension under the microscope. Accordingly, after incubating the cells with Concanavalin-A beads, put the sample tubes on the magnetic rack, and the supernatant should be again observed using a microscope. This is to assess how efficiently the cells have been captured by Concanavalin-A beads. Wash buffer containing 7 x 10⁵ cells/mL should look like Figure 1A under the microscope. In contrast, Figure 1B shows the supernatant after Concanavalin-A bead binding, where the beads have taken away all the cells. There is no point in proceeding into the following steps of CUT&Tag if the Concanavalin-A beads did not even capture cells efficiently. Wash buffer should not contain any serum content or EDTA/EGTA, as they can abolish the binding of cell membrane to Concanavalin-A beads. Bovine serum albumin, however, does not interfere with Concanavalin-A binding to cells.

After making the CUT&Tag libraries by PCR, a small aliquot of the library (3-4 µL) can be electrophoresed on a 1.2-1.5% agarose gel to test whether the library is good. Figure 2 shows the example of successful H3K4me1 CUT&Tag libraries we made. In a histone mark or histone variant CUT&Tag, the majority of cleaved units are apparently mono-nucleosomes, although two nucleosomes can also be cut out together. Three nucleosomes cut and tagged altogether would be very rare. Therefore, a nucleosome array containing mono-nucleosomes, di-nucleosomes, and very few tri-nucleosomes should be observed in the electrophoresis of histone mark CUT&Tag libraries. Nucleosomes contain 147 bp of DNA, but with the sequencing adaptors added by Tn5 transposase and library PCR, the total size of a CUT&Tagged mono-nucleosome should come by 300 bp, as shown in Figure 2.

Before spending money on high-throughput sequencing of the CUT&Tag libraries, another quality control method is to perform qPCR with locus-specific primers. This is equivalent to performing ChIP-qPCR. Moreover, the locus-specific primers in CUT&Tag qPCR are designed based on the same principles as ChIP-qPCR primers. Figure 3 shows the qPCR amplification of different locations on the Myod1 gene locus. Myod1 encodes the master transcription factor, MyoD, which determines the skeletal muscle lineage during myogenesis¹⁵. As shown in Figure 3, H3K4me1 is highly enriched at the core enhancer (CER) and distal regulatory region (DRR) of Myod1 locus. CER and DRR are very well-established enhancer regions for Myod1¹⁶. This is consistent with the well-documented phenotype that H3K4me1 specifically marks commissioned enhancers¹⁷. Moreover, Figure 3 shows that the H3K4me1 level is very low at the proximal regulatory region (PRR) because the nucleosomes at the proximal region of active promoters are normally modified with H3K4me3¹⁸ instead of H3K4me1. All the primer pairs for these assessed loci are previously published^19,20, and the sequences can be found in Table 4. Normally, after the quality controls by library DNA electrophoresis and qPCR on specific loci, the researchers will be confident to proceed with sequencing.

Figure 1: Myoblasts resuspended in Wash buffer. Microscopic views taken (A) before and (B) after Concanavalin-A bead binding. Panel B shows there are almost no cells left in the suspension after Concanavalin-A bead incubation, indicating cells have been efficiently captured by the beads. The small particles in panel B are likely to be the excessive Concanavalin-A beads. Please click here to view a larger version of this figure.

Figure 2: Electrophoresis of CUT&Tag libraries. Three independent H3K4me1 CUT&Tag assays have been performed, and each was made into a sequencing library using Illumina primers and PCR. Each H3K4me1 CUT&Tag used 70,000 mouse myoblasts. Libraries mostly contain tagged mono-nucleosomes. Please click here to view a larger version of this figure.

Figure 3: qPCR amplification of different locations on Myod1 gene locus. qPCR shows that in mouse myoblasts, the H3K4me1 mark is highly enriched at the enhancer regions of the Myod1 gene, which aligns with published conclusions. CER and DRR are published enhancers of Myod1 which are located upstream of Myod1 promoter. Please note that the PRR does not have H3K4me1 accumulation, and this is also consistent with the fact that active promoters are mainly marked with H3K4me3. The enrichments were calculated by normalizing to the enrichment of H3K4me1 on "gene desert" of sample "Repeat 1". Please click here to view a larger version of this figure.

Name	Sequences (5’-3’):
Oligo-Rev	phos-CTGTCTCTTATACACATCT
Oligo-A	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Oligo-B	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Table 1: Oligo sequences for making Adaptor-A and Adaptor-B to be mounted onto pA/G-Tn5 transposase.

Fraction	Volume
Purified genomic DNA after CUT&Tag reaction	21 µL
N5XX primer (10 µM)	2 µL
N7XX primer(10 µM)	2 µL
NEBNext High-Fidelity 2× PCR Master Mix	25 µL
	Total 50 µL

Table 2: PCR setup for CUT&Tag library preparation using Illumina indexing primers. If using a commercial CUT&Tag kit that contains library PCR reagents such as DNA polymerase mix, follow the specific manual of that kit to set up the library PCR.

Step	Temperature	Time	Cycle number
1	72 oC	3 min	1
2	95 oC	3 min	1
3	98 oC	10 s	9 to 14
4	60 oC	5 s, then go to step 3
5	72 oC	1 min	1
6	4 oC	hold	N/A

Table 3: PCR program for CUT&Tag library preparation using Illumina indexing primers.

Location	Primer sequences (5’-3’)
CER	For: GGG CAT TTA TGG GTC TTC CT
	Rev: CTC ATG CCT GGT GTT TAG GG
-15,000	For: TGC CCA GAG CCT AGA ATC AT
	Rev: TCA TGC ATC CTT GCT GGA TA
-7,000	For: GGC ATG GGA GGT TTA TAG CA
	Rev: ATG CCA CTA TGC AAT CCA CA
DRR	For: TCA GGA CCA GGA CCA TGT CT
	Rev: CTG GAC CTG TGG CCT CTT AC
PRR	For: GAG TAG ACA CTG GAG AGG CTT GG
	Rev: GAA AGC AGT CGT GTC CTG GG
CDS1	For: CAT CTG ACA CTG GAG TCG CTT TG
	Rev: CAA GCA ACA CTC CTT GTC ATC AC
CDS2	For: GTG AGC CTT GCA CAC CTA AGC C
	Rev: GTT GCA CTA CAC AGC ATG CCT G
IgH enhancer	For: ACC CTG GGA AGA CCA TAC TTA ATC T
	Rev: CCA TCC ACA CTC GTG CCT TA
Gene desert	For: TCC TCC CCA TCT GTG TCA TC
	Rev: GGA TCC ATC ACC ATC AAT AAC C

Table 4: Locus-specific primers for testing H3K4me1 enrichment at different locations on the Myod1 gene.

Discussion

The specific cell number required in a certain CUT&Tag reaction completely relies on the enrichment of the histone marks/variants or chromatin-binding proteins that are to be tested. Normally for very enriched histone marks such as H3K4me1, H3K4me3, and H3K27ac etc., 25,000-50,000 myoblasts are quite sufficient for one CUT&Tag reaction. However, some rare chromatin-binding proteins might require up to 250,000 cells. The cell number used in CUT&Tag assays is critical, which, if not handled well normally causes the failure of the assay. Using an excessive number of cells in a CUT&Tag reaction is detrimental, especially when testing very enriched histone marks. Starting with too many cells means insufficient antibodies allocated for each cell. CUT&Tag not only works with very low cell numbers, it can actually be applied at single cell level¹.

Above all, using a reliable and validated antibody with high affinity and specificity is always the key to a successful CUT&Tag assay. Same as ChIP, Immunoprecipitation (IP), and IF assays, CUT&Tag also requires the type of antibodies that can recognize the naturally folded antigens¹. In contrast, the antibodies that only recognize relaxed peptides in Western blot should be strictly avoided in the CUT&Tag.

If optimizing the cell number or using an immunofluorescence-validated or well-cited antibody still cannot solve the poor signal problem in a CUT&Tag assay, then look into whether the protein of interest is a chromatin-associated protein that weakly binds or does not even bind to DNA directly. In this case, as mentioned before, switch to using CUT&RUN instead of CUT&Tag. Alternatively, slight fixation, such as 5 min in 0.5% paraformaldehyde (followed by 10 min quenching in 0.1 M glycine), might be a method worth being tested. However, as we have never practiced the fixation in any CUT&Tag assays, nor have we even run into the need to fix the cells before performing CUT&Tag, no further comments can be made by us regarding cross-linking.

We understand that some versions of CUT&Tag protocols might claim that both RT (2 h) and 4 °C (overnight) for the primary antibody incubation step can generate decent results²¹. We however strongly recommend using 4 °C (overnight) as opposed to RT for 2 h. On the other hand, extending the incubation time longer than one night is also not recommended.

Regarding sensitivity, background controlling, and degree of complexity for researchers to handle, CUT&Tag is superior to ChIP assays. If some drawbacks have to be put for CUT&Tag compared to ChIP, then the only one is that CUT&Tag protocols do not include an internal normalization method such as using "Input" in a ChIP assay¹. Therefore, when comparing peak heights between samples using CUT&Tag, researchers must equalize the cell number among samples to start with. Also, it is critical to include technical replicates.

This protocol presents the full details of performing CUT&Tag in mouse myoblasts by providing a successful example of H3K4me1 CUT&Tag in this cell type. The method described here can be directly applied to freshly isolated MuSCs without any modifications. Moreover, CUT&Tag experiments on histone marks, histone variants, or transcription factors in other cell types can also be carried out following this protocol. For myotubes or myofibers, the nuclei can be isolated first, and CUT&Tag can then be carried out on the myonuclei. When doing this, one can treat the nuclei the same way as cells are treated in this CUT&Tag protocol. Myotubes and myofibers are multi-nucleated cells, and we have not tested whether myotubes or myofibers can be directly bound onto Concanavalin-A beads, although this might be feasible.

Materials

Name	Company	Catalog Number	Comments
bFGF	R&D Systems	233-FB-025
Collagen	Corning	354236
Collagenase II	Worthington	LS004177
Concanavalin-A	Sigma-Aldrich	C5275
Concanavalin-A beads	Bangs Laboratories	BP531
Digitonin	Sigma-Aldrich	300410
Dispase II	Thermo Fisher Scientific	17105041
Fetal bovine serum	Hyclone	SH30396.03
H3K4me1 antibody	abcam	ab8895
Ham's F10 media	Thermo Fisher Scientific	11550043
Hyperactive Universal CUT&Tag Assay Kit for Illumina	Vazyme	TD903	This kit has been tested by us to function well
Magnetic rack for 1.5 mL EP tubes	Qualityard	QYM06
Magnetic rack for 8-PCR tube stripes	Anosun Magnetic	CLJ16/21-021
NEBNext High-Fidelity 2x PCR Master Mix	NEB	M0541L	For library-making PCR reaction
pA-Tn5	Vazyme	S603-01	Needs to be mounted with adaptors before use
Protease inhibitor cocktail	Sigma-Aldrich	5056489001
Proteinase K	Beyotime	ST535-100mg
RPMI-1640 media	Thermo Fisher Scientific	C11875500BT
Secondary antibody (Guinea Pig anti-rabbit IgG)	Antibodies-online	ABIN101961
Spermidine	Sigma-Aldrich	S2626
TruePrep Index Kit V2 for Illumina	Vazyme	TD202	This kit provide Illumina N7XX and N5XX primers
VAHTS DNA Clean Beads	Vazyme	N411	Can substitute Ampure XP beads. Can purify CUT&Tag libraries and select DNA fragments by size