Inductie van Maternal Immune Activering in Muizen bij Mid-dracht Podium met Viral Mimic Poly (I: C)
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
Het concept van de moeder immuun activering (MIA) is afkomstig van de epidemiologische studies over de associatie van maternale infectie met autisme en schizofrenie 1. Door de afwezigheid van detecteerbare replicerende virale pathogenen in de placenta en de foetale hersenen na maternale virale infectie 2,3, is het effect van de besmetting van het nageslacht verondersteld te worden veroorzaakt door de activering van de maternale immuunsysteem in plaats van de pathogenen zelf .
polycytidylic zuur: de oorzaak-en-gevolg relatie tussen MIA en psychiatrische stoornissen, injectie van chemisch gesynthetiseerde, virale mimic dubbelstrengs RNA polyinosinic helderen (poly (I: C)) in zwangere knaagdieren is op grote schaal gebruikt als diermodel voor MIA 4,5. Poly (I: C) wordt herkend door Toll-like receptor 3 (TLR3) en systemische toediening van poly (I: C) induceert virusachtige acute ontstekingsreactie. Eén van de mechanismen waarmee poly (I: C) produces gedragsafwijkingen en neuropathologieën in het nageslacht is door het veroorzaken van een verstoring van de pro- en anti-inflammatoire cytokines in de moederlijke-placenta-foetale as 6. Verschillende groepen hebben de MIA model om de etiologie van psychiatrische aandoeningen 7 konden begrijpen, en vanwege de uiteenlopende belangen tussen onderzoeksgroepen hebben verschillende tijdstippen van immuunactivering gebruikt om verschillende verstoringen op de hersenontwikkeling en gedrag 7 bereiken.
Paul H. Patterson laboratorium aan het California Institute of Technology neemt de strategie injecteren poly (I: C) in zwangere muizen op embryonale dag 12,5 (E12.5), die met succes heeft aangetoond dat MIA kan induceren gedrags-, neurologische, en immunologische veranderingen in de nakomelingen die zijn geassocieerd met autisme en schizofrenie 8-11. Onze eerdere werken tonen aan dat MIA nakomelingen geven gedragsafwijkingen (bijvoorbeeld sociale impairment, communicatie tekort, repetitief gedrag, angst-achtig gedrag, en latente remming tekort 8,10,12), immuun ontregeling en cytokines onbalans 8,13,14, verandering van foetale hersenen genexpressie 15, verlies van Purkinje cel in kwabje VII van cerebellum 11, wijziging van synaptische woningen in hippocampus 9, gen x omgeving interactie 13, wijziging van de darm permeabiliteit en darmflora samenstelling 16. Verder worden therapeutische en profylactische strategieën ook ontwikkeld op basis van dit model systeem 13,16,17. Door het induceren van MIA op E12.5, anderen hebben aangetoond dat MIA produceert foetale microgliale activatie en cholinerge ontwikkelingsstoornissen veranderingen in de basale voorhersenen 18, stam specifieke interactie 19, hersen hersenen synaptosomale ultrastructurele afwijkingen, cerebrale mitochondriale ademhalingsketen hyperfunctie abnormalties, neerwaartse regulatie van cerebrale synaptosomale moleculen 17 ,depressieve-achtig gedrag, beperkingen in cognitie en hippocampus langetermijnpotentiëring (LTP), en het tekort van de volwassen hippocampus neurogenese 20.
Hier geven we een gedetailleerde methode hoe MIA induceren bij E12.5 door poly (I: C), alsmede paradigma van hoe dit model toepassen op de etiologie van schizofrenie en autisme bestuderen. Het is belangrijk op te merken dat MIA is een risicofactor voor diverse aandoeningen 4, en de resultaten zijn zeer gevoelig voor de tijd en methode van inductie en de verzorging van de zwangere dammen. Daarom, zelfs kleinere inconsistenties tussen laboratoria vaak tot lage reproduceerbaarheid en / of verschillende fenotypen bij het nageslacht. Onze methode is speciaal ontworpen voor diegenen die geïnteresseerd zijn in het bestuderen van MIA als een risicofactor milieu voor autisme en schizofrenie, en de gedetailleerde beschrijving voorzien zal onderzoekers helpen verbeteren van de reproduceerbaarheid van hun gegevens.
Protocol
Representative Results
Discussion
MIA inductie op verschillende tijdstippen ramen verstoort de verschillende ontwikkeling van de hersenen gebeurtenissen in knaagdieren, en dus leidt tot verschillende gedragsafwijkingen en neuropathologieën in het nageslacht. Hier beschrijven we een protocol om MIA induceren in muizen met poly (I: C) injectie op E12.5. Deze methode van MIA inductie leidt tot gedragsmatige, neurologische, immunologische en gastro-intestinale afwijkingen geassocieerd met autisme en schizofrenie in het nageslacht 8,10,11,16. Het…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
We willen graag de late Dr. Paul H. Patterson te eren voor zijn bijdragen aan de vooruitgang van de MIA-model, autisme en schizofrenie onderzoek. Wij erkennen Sarkis K. Mazmanian voor zijn grote steun op dit protocol; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni en Leslie A. Neumann voor administratieve bijstand; Ali Khoshnan en Jan C. Ko voor de hulp bij het filmen; Elaine Y. Hsiao en Natalia Malkova voor hun advies over MIA inductie; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, en Natalie A. Verduzco voor hun deskundige veeteelt. Dit werk werd ondersteund door de NIH Conte Center Award (NIH 5P50MH086383-04, Paul H. Patterson); Autism Speaks (# 7670, aan Paul H. Patterson); Simons Foundation (# 322839, om Sarkis K. Mazmanian); NIH Training Grant (NIH / NRSA T32GM07616 K.-HC); Caltech Summer Undergraduate Research Fellowship (SURF) (tot ZY); Amgen Scholars Program aan Caltech (tot ZY); en Postdoctoral Fellowship frOM National Science Council, Taiwan (NSC 101-2917-I-564-039, tot W.-LW).
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
Referenzen
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H. et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., & Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I. et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., & Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., & Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., & Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., & Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L. et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., & Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L. et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., & McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., & Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2 e98 (2012).
- Hsiao, E. Y. et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K. et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., & Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J. et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3 e240 (2013).
- Khan, D. et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4 e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., & Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B. et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U. et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S. et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., & Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., & Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
