(: C I) 바이러스 성 모방 폴리와 중간 임신 단계에서 마우스의 모성 면역 활성화 유도
Summary
Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.
Abstract
Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.
Introduction
산모의 면역 활성화의 개념 (MIA)는 자폐증과 정신 분열증 1 모성 감염의 연관성에 대한 역학 연구에서 유래. 인해 태반 또는 바이러스 감염 모체 2,3- 후 태아 뇌에서 검출 가능한 복제 바이러스 병원체의 부재에, 자손에 감염의 효과가 오히려 병원체 자체보다 모체 면역 시스템의 활성화에 의한 것으로 가정한다 .
polycytidylic 산 : MIA와 정신 장애, 화학적으로 합성, 바이러스 성 모방 이중 가닥 RNA의 polyinosinic의 주입 사이의 인과 관계를 규명하기 : 임신 설치류에 (폴리 (I C)) 널리 MIA의 동물 모델로 사용되어왔다 4,5. 폴리는 (I : C) 수신자 같은 수용체 3 (TLR3) 및 폴리의 전신 투여 인식 (난 : C)은 바이러스와 같은 급성 염증 반응 유도한다. 메커니즘 중 하나되는 폴리으로 (I : C) 홍보자손에 oduces 행동 이상과 neuropathologies는 산모 – 태반 – 태아 축 6 프로와 항 염증성 사이토 카인의 불균형을 초래하는 것입니다. 몇몇 그룹은 정신 장애 (7)의 원인을 이해하는 MIA 모델을 채용 한 의한 연구 그룹 중에서 다양한 관심사 면역 활성화의 다양한 시점은 뇌 발달과 행동 7 상이한 섭동을 달성하기 위해 사용되었다.
배아 12.5 일에서 임신 한 쥐에 성공적으로 MIA는 행동, 신경을 유도 할 수 있음을 보여 주었다 (E12.5)을, (C I) 캘리포니아 기술 연구소의 폴 H. 패터슨 연구소는 폴리를 주입하는 전략을 채택 자폐증과 정신 분열증 8-11과 관련된 자손의 면역 학적 변화. 우리의 이전 작품 MIA의 자손이 행동 이상 (예를 들어, 사회 impairmen을 표시 보여t, 통신 결핍, 반복 행동, 불안 같은 행동 및 잠재 억제 적자 8,10,12), 면역 조절 곤란 및 사이토 카인 불균형 8,13,14, 태아의 뇌 유전자 발현 (15)의 변경, 소엽 VII에 조롱박 세포의 손실 소뇌 (11), 해마 9 시냅스 특성의 변화, 유전자 X 환경의 상호 작용 (13), 장 투과성의 변화 및 장내 미생물 조성 16. 또한, 치료 및 예방 전략이 모델 시스템 13,16,17에서 개발된다. E12.5에서 MIA을 유도함으로써, 다른 MIA는 뇌 synaptosomal 분자 (17)의 태아 미세 아교 활성화 및 기저 전뇌 (18)의 콜린성 발달 변경, 변형 특정 상호 작용 (19), 뇌 뇌 synaptosomal 미세 구조의 이상, 뇌 미토콘드리아 호흡 연쇄 항진의 abnormalties, 하향 조절을 생산하는 것으로 나타났습니다 ,우울증 같은 행동,인지와 해마 장기 강화 (LTP)의 손상, 성인 해마 신경 (20)의 적자.
(C : I)뿐만 아니라, 자폐증, 정신 분열증의 병인을 연구 모델을 적용하는 방법에 대한 패러다임 여기서는 폴리 의해 E12.5에서 MIA을 유도하는 방법의 상세한 방법을 제공한다. 이 장애는 4 MIA 다양한 위험 인자 인 것이 중요하고, 그 결과 시간 및 유도 방법뿐만 아니라, 임신 댐 축산에 매우 민감하다. 따라서, 실험실간에 사소한 불일치는 종종 낮은 재현성 및 / 또는 자손 다른 표현형을 초래한다. 우리의 방법은 특별히 자폐증, 정신 분열증에 대한 환경 적 위험 인자로 MIA 연구에 관심을 위해 설계되고, 상세한 설명은 연구자들이 데이터의 재현성을 향상시킬 것이다 제공.
Protocol
Representative Results
Discussion
서로 다른 시간 창에서 MIA 유도는 설치류에서 다른 두뇌 발달 이벤트를 교란, 결과적으로 자손에 다른 행동 이상과 neuropathologies에 연결됩니다. E12.5에 주입 : 여기, 우리는 폴리 (C I)와 마우스에서 MIA를 유도 할 수있는 프로토콜을 설명했다. MIA 유도의이 방법은 행동, 신경 학적, 면역 학적, 그리고 자손 8,10,11,16에서 자폐증과 정신 분열증과 관련된 위장관 이상에 연결됩니다. MIA는 환경 적 ?…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
우리는 MIA 모델, 자폐증, 정신 분열증 연구의 발전에 공헌을 위해 후반 박사 폴 H. 패터슨을 존중하고 싶습니다. 우리는이 프로토콜에 대한 그의 위대한 지원 Sarkis K. Mazmanian을 인정; 행정 지원 루벤 M. 바이욘, 이벳 가르시아 – 플로레스, 카렌 C. Lencioni, 그리고 레슬리 A. 노이만; 촬영에 도움을 알리 Khoshnan 및 월 C. 코; MIA 유도에 자신의 조언을 일레인 Y. 샤오와 나탈리아 Malkova; 자신의 전문 축산에 대한 제프리 S. 코크, 호아킨 구티에레즈, 콴 F. 리, 제이미로드 리 게스, 로레나 C. 산도발, 나탈리 A. Verduzco. 이 작품은 (폴 H. 패터슨에 NIH 5P50MH086383-04,)를 NIH 콘테 센터 수상에 의해 지원되었다; 자폐증은 (폴 H. 패터슨에 # 7670) 언어; (Sarkis K. Mazmanian에 # 322839) 시몬스 재단; NIH 교육 그랜트 (K.-HC에 NIH / NRSA T32GM07616); (ZY에) 캘리포니아 공과 대학 여름 학부 연구 활동 (SURF); 암젠 학자 캘리포니아 공과 대학에서 (ZY에) 프로그램; 및 박사후 친목 FR톰 국립 과학위원회, 대만 (NSC 101-2917-I-564-039, W.-LW)이다.
Materials
| Polyinosinic–polycytidylic acid potassium salt | SIGMA | P9582 | |
| 0.9% sodium chloride INJ. USP | HOSPIRA | NDC 0409-4888-10 | |
| MONOJECT insuline syrinage 3/10 mL 29G x 1/2" | COVIDIEN | 8881600145 | |
| 50 ml conical screw cap tubes | USA SCIENTIFIC | 1500-1211 | |
| Nanodrop 1000 spectrophotometer | THERMO SCIENTIFIC | 1000 | Optional |
| Stereomicroscope | Wild Heerbrugg | M5A | Optional |
| Dumont #5 Forceps Inox Tip Size .10 X .06mm | Roboz | RS-5045 | Optional |
| RNAlater RNA stabilization reagent | Qiagen | 76104 | Optional |
| TRIzol reagent | Life Technologies | 15596-026 | Optional |
| RQ1 Rnase-free DNase | Promega | M610A | Optional |
| iScript cDNA synthesis kit | Bio-Rad | 170-8891 | Optional |
| FastStart universal SYBR green master mix with ROX | Roche | 4913922001 | Optional |
| Real-time PCR | ABI | 7300 | Optional |
| Primer: Il6 forward | Life Technologies | TAGTCCTTCCTACCCCAATTTCC | Optional |
| Primer: Il6 Reverse | Life Technologies | TTGGTCCTTAGCCACTCCTTC | Optional |
| Primer: beta-actin forward | Life Technologies | AGAGGGAAATCGTGCGTGAC | Optional |
| Primer: beta-actin Reverse | Life Technologies | CAATAGTGATGACCTGGCCGT | Optional |
| MicroAmp optical 96-well reaction plate | Life Technologies | 4306737 | Optionl |
| MicroAmp optical adhesive film | Life Technologies | 4311971 | Optionl |
| EthoVision | Noldus | EthoVision | Optionl |
| SR-LAB apparatus (PPI) | San Diego Instruments | SR-LAB | Optionl |
| Marbles | PENN-PLAX | Blue gem stones marbles | Optionl |
| Dulbecco's Phosphate-Buffered Saline (DPBS) | Life Technologies | 21600-069 | Optionl |
| Paraformaldehyde | MACRON | 2621-59 | Optionl |
| Vibratome | Leica | VT1000 S | Optionl |
| Sodium azide | Sigma | S2002 | Optionl |
| Triton x-100 | Sigma | X100 | Optionl |
| Hydrogen peroxide solution | Sigma | 18312 | Optionl |
| Goat serum | Vector Laboratories | S-1000 | Optionl |
| Rabbit anti-calbindin antibody | Abcam | ab11426 | Optionl |
| Biotinlyated goat anti-rabbit IgGantibody | Vector Laboratories | BA-1000 | Optionl |
| VECTASTAIN ABC Kit | Vector Laboratories | PK-4000 | Optionl |
Referenzen
- Brown, A. S. Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism. Dev Neurobiol. 72 (10), 1272-1276 (2012).
- Fatemi, S. H. et al. The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring. Neuropharmacology. 62 (3), 1290-1298 (2012).
- Shi, L., Tu, N., & Patterson, P. H. Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus. Int J Dev Neurosci. 23 (2-3), 299-305 (2005).
- Knuesel, I. et al. Maternal immune activation and abnormal brain development across CNS disorders. Nat Rev Neurol. 10 (11), 643-660 (2014).
- Meyer, U. Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems. Biol Psychiatry. 75 (4), 307-315 (2014).
- Meyer, U., Feldon, J., & Yee, B. K. A review of the fetal brain cytokine imbalance hypothesis of schizophrenia. Schizophr Bull. 35 (5), 959-972 (2009).
- Boksa, P. Effects of prenatal infection on brain development and behavior: a review of findings from animal models. Brain Behav Immun. 24 (6), 881-897 (2010).
- Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., & Patterson, P. H. Modeling an autism risk factor in mice leads to permanent immune dysregulation. Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).
- Ito, H. T., Smith, S. E., Hsiao, E., & Patterson, P. H. Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring. Brain Behav Immun. 24 (6), 930-941 (2010).
- Smith, S. E., Li, J., Garbett, K., Mirnics, K., & Patterson, P. H. Maternal immune activation alters fetal brain development through interleukin-6. J Neurosci. 27 (40), 10695-10702 (2007).
- Shi, L. et al. Activation of the maternal immune system alters cerebellar development in the offspring. Brain Behav Immun. 23 (1), 116-123 (2009).
- Hsiao, E. Y., & Patterson, P. H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav Immun. 25 (4), 604-615 (2011).
- Wu, W. L. et al. The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring. Brain Behav Immun. (2015).
- Garay, P. A., Hsiao, E. Y., Patterson, P. H., & McAllister, A. K. Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development. Brain Behav Immun. 31 54-68 (2013).
- Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., & Mirnics, K. Effects of maternal immune activation on gene expression patterns in the fetal brain. Transl Psychiatry. 2 e98 (2012).
- Hsiao, E. Y. et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 155 (7), 1451-1463 (2013).
- Naviaux, R. K. et al. Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model. PLoS One. 8 (3), e57380 (2013).
- Pratt, L., Ni, L., Ponzio, N. M., & Jonakait, G. M. Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6. Pediatr Res. 74 (4), 393-401 (2013).
- Schwartzer, J. J. et al. Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice. Transl Psychiatry. 3 e240 (2013).
- Khan, D. et al. Long-term effects of maternal immune activation on depression-like behavior in the mouse. Transl Psychiatry. 4 e363 (2014).
- Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., & Finlay, B. L. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33 (17), 7368-7383 (2013).
- Abazyan, B. et al. Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology. Biol Psychiatry. 68 (12), 1172-1181 (2010).
- Meyer, U. et al. Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling. Mol Psychiatry. 13 (2), 208-221 (2008).
- Vuillermot, S. et al. Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments. J Neurosci. 32 (2), 436-451 (2012).
- Bechard, A., Nicholson, A., & Mason, G. Litter size predicts adult stereotypic behavior in female laboratory mice. J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).
- Harvey, L., & Boksa, P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology. 62 (4), 1767-1776 (2012).
