JoVE Journal > Medicine
Summary
Abstract
Introduction
Protocol
Resultados
Discussion
Divulgaciones
Acknowledgements
Materials
Referencias
Traducción Automática
Please note that all translations are automatically generated. Click here for the English version.
Medicina

إعداد و<em> في المختبر</em> توصيف ممغنط مير تعديل الخلايا البطانية

Published: May 02, 2017
doi:
10.3791/55567
, , , , , ,
1Reference and Translation Center for Cardiac Stem Cell Therapy (RTC), Department of Cardiac Surgery,University of Rostock, 2Physikalisch-Technische Bundesanstalt, 3Department of Radiology and Neuroradiology,Ernst-Moritz-Arndt-University Greifswald, 4Electron Microscopy Center,University of Rostock

Summary

توضح هذه المخطوطة كفاءة، والتسليم غير فيروسي مير إلى الخلايا البطانية التي كتبها ناقل PEI / MNP ومغنطة بهم. وهكذا، بالإضافة إلى التعديل الوراثي، ويسمح هذا النهج لتوجيه الخلايا المغناطيسي MRI والكشف. هذه التقنية يمكن استخدامها لتحسين خصائص المنتجات خلية العلاجية.

Abstract

حتى الآن، فإن العلاجات الجراحية والدوائية المتاحة لأمراض القلب والأوعية الدموية (الأمراض القلبية الوعائية) محدودة وغالبا ما الملطفة. وفي الوقت نفسه، الجينات والخلايا العلاجات هي النهج البديلة واعدة للغاية لعلاج الأمراض القلبية الوعائية. ومع ذلك، فإن التطبيق السريري واسعة من العلاج الجيني يقتصر إلى حد كبير بسبب عدم وجود أنظمة توصيل الجينات المناسبة. تطوير ناقلات توصيل الجينات المناسبة يمكن أن توفر حلا للتحديات الراهنة في العلاج بالخلايا. وعلى وجه الخصوص، السلبيات الموجودة، مثل كفاءة محدودة ومنخفضة الاحتفاظ الخلايا في الجهاز المصاب، يمكن التغلب عليها عن طريق الهندسة الخلية المناسبة (أي الوراثية) قبل الزرع. يصف بروتوكول المعروضة تعديل عابر فعالة وآمنة من الخلايا البطانية باستخدام جسيمات متناهية الصغر polyethyleneimine مغنطيسية مسايرة فائقة superparamagnetic المغناطيسي (PEI / MNP) المستندة إلى متجه التسليم. أيضا، يتم تعريف خوارزمية والأساليب لتوصيف الخلية. وintracellu ناجحةوقد حقق تسليم لار من الرنا الميكروي (مير) في الوريد السري الخلايا البطانية الإنسان (HUVECs) دون التأثير على بقاء الخلية، وظائف، أو الاتصالات بين الخلايا. وعلاوة على ذلك، فقد أثبت هذا النهج لإحداث تأثير وظيفي قوي في خارجية المنشأ قدم مير. الأهم من ذلك أن تطبيق هذا ناقل القائمة MNP-يضمن مغنطة الخلية، مع المرافق إمكانيات استهداف المغناطيسي MRI وتتبع غير الغازية. وهذا قد تقدم أساسا لتسترشد مغناطيسيا، علاجات الخلايا المعدلة وراثيا التي يمكن رصدها غير جراحية مع التصوير بالرنين المغناطيسي.

Introduction

الجينات والعلاج بالخلايا هي أدوات قوية لديها القدرة على حل التحديات الراهنة في علاج الأمراض القلبية الوعائية. وعلى الرغم من أن كلا من هذين النهجين يجري حاليا اختبارها في التجارب السريرية، فهي ليست مستعدة بعد للالتطبيق السريري واسعة 1. والجدير بالذكر أن نهج مشترك لمواجهة التحديات من الجينات والعلاج بالخلايا هو تطوير ناقلات توصيل الجينات متعددة الوظائف مناسبة لتطبيق السريرية. عدم وجود أنظمة توصيل الجينات آمنة وفعالة هو مصدر القلق الرئيسي من العلاج الجيني. في الوقت نفسه، والهندسة الوراثية من المنتجات الخلوية قبل الزرع يمكن التغلب على التحديات الخطيرة للعلاج الخلايا، مثل انخفاض الكفاءة (على سبيل المثال، في مجال القلب، ويتحقق فقط ~ 5٪ من تحسين وظيفي بعد الخلايا الجذعية زرع 1 ) وضعف الاحتفاظ / engraftment في موقع الإصابة (أي الاحتفاظ خلية تنخفض 5-10٪ في غضون دقائق إلى ساعات بوالحادي والتطبيق، بغض النظر عن مسار إدارة 2، 3، 4).

حتى الآن، ناقلات فيروسية تتجاوز الى حد كبير أنظمة غير الفيروسية من حيث الكفاءة، مما أدى إلى تطبيقها على نطاق أوسع في التجارب السريرية (~ 67٪) 5. ومع ذلك، والمركبات الفيروسية تحمل مخاطر جسيمة، مثل المناعية (والاستجابة الالتهابية لاحقة، مع مضاعفات خطيرة)، قدرة التوريم، والقيود في حجم المادة الوراثية تنفيذ 6. بسبب هذه المخاوف المتعلقة بالسلامة وارتفاع تكاليف الإنتاج ناقلات فيروسية، واستخدام أنظمة غير الفيروسية هو الأفضل في بعض الحالات 7 و 8. انها مناسبة خاصة للاضطرابات التي تتطلب التصحيح الجيني عابرة، مثل التعبير عن عوامل النمو السيطرة على الأوعية الدموية (على سبيل المثال، لعلاج الأمراض القلبية الوعائية) أو deliveراي من اللقاحات.

في مجموعتنا، تم تصميم نظام التسليم عن طريق الجمع بين تشعبت 25 كيلو دالتون polyethyleneimine (PEI) وجزيئات أكسيد الحديد مغنطيسية مسايرة فائقة superparamagnetic (MNP) تربطهم البيوتين streptavidin التفاعل 9. هذه النواقل هو أداة محتملة للهندسة الوراثية للخلايا، مما يسمح للمغنطة في وقت واحد من قبل الزرع. يوفر هذا الأخير أساسا لالمغناطيسي التوجيه / الاحتفاظ بها، وهي واعدة خاصة في الوقت الحاضر، وأساليب الاستهداف المتقدمة المغناطيسي ويجري حاليا وضع بنجاح (10). وعلاوة على ذلك، مما أدى الخلايا تستجيب مغناطيسيا لديها القدرة على أن تكون غير جراحية رصدها بواسطة التصوير بالرنين المغناطيسي (MRI) أو التصوير الجسيمات المغناطيسية 11 و 12.

في حالة حدوث الموجه PEI / MNP، البولي أمينات يضمن التكثيف الحمض النووي، وبالتالي الحماية من عامل المهينة الصورة، استيعاب ناقلات في الخلايا، وendosomal الهروب 5. وMNPs تكمل خصائص جزيرة الأمير إدوارد، وليس فقط من حيث التوجيه المغناطيسي، ولكن أيضا عن طريق الحد من المعروف PEI سمية 7 و 13 و 14. سابقا، تم تعديل PEI / MNP خصائص ناقلات من حيث الكفاءة والتسليم (أي PDNA وميرنا) والسلامة باستخدام الخلايا الليفية والخلايا الجذعية الوسيطة الإنسان 15 و 16.

في هذه المخطوطة، يوصف بروتوكول مفصلة على تطبيق مبادرة التعليم الفلسطينية / MNPs لتوليد الخلايا المعدلة ميرنا 17. لهذا الغرض، وتستخدم HUVECs وتمثل نموذجا أنشئت لفي المختبر الأوعية الدموية. فهي صعبة ل transfect وعرضة للتأثير السام 18، 19،الحمار = "XREF"> 20. وبالإضافة إلى ذلك، ونحن نقدم خوارزمية لتقييم مثل هذه الخلايا في المختبر، بما في ذلك الاستهداف، والاتصالات بين الخلايا، وكشف التصوير بالرنين المغناطيسي.

Protocol

وقد تم الحصول على الحبل السري الإنسان لعزل الخلايا بعد الولادة من علم والنساء الأصحاء الذين أعطى موافقتهم الخطية على استخدام هذه المواد لأغراض البحث وفقا لإعلان هلسنكي. وافقت لجنة أخلاقية من جامعة روستوك الدراسة التي قدمت (ريج. رقم أ 2011 06، لفترة طويلة 23 سبتمبر 201…

Representative Results

والغرض الرئيسي من البروتوكول المقترح هو إنتاج الخلايا المستجيبة مغناطيسيا مير المعدلة وإجراء توصيف دقيق لها (الشكل 1). ونتيجة لذلك، والخلايا transfected بكفاءة، تستجيب لاختيار المغناطيسية والتوجيه وكشف مع التصوير بالرنين المغناطيسي، يجب الحص?…

Discussion

يتم تقديم إنتاج خلايا معدلة وراثيا محملة النانوية مغنطيسية مسايرة فائقة superparamagnetic لتوجيهاتهم مزيد من التحكم مغناطيسيا في البروتوكول الحالي. التطبيق الناجح لهذه الاستراتيجية تسمح لتسوية بعض الصعوبات من العلاج بالخلايا، مثل انخفاض الاحتفاظ والفقراء engraftment في المنط?…

Divulgaciones

The authors have nothing to disclose.

Acknowledgements

ونود أن نشكر G. فولدا (مركز المجهر الإلكتروني، جامعة روستوك، ألمانيا) للدعم الفني في الحصول على الصور TEM النانوية مغنطيسية مسايرة فائقة superparamagnetic تصفيتها وفي إجراء تحليل الأشعة السينية الخاصة بهم. وأيد الأعمال التي تقوم بها في RTC روستوك من قبل الوزارة الاتحادية للتعليم والبحوث ألمانيا (FKZ 0312138A، FKZ 316159 وVIP + 03VP00241) والدولة كروا مكلنبورغ الغربية مع الصناديق الهيكلية للاتحاد الأوروبي (ESF / IV-WM-B34- 0030/10 وكلية العلوم التربوية / IV-BM-B35-0010 / 12) والتي DFG (DA 1296-1)، والرطوبة، مؤسسة، ومؤسسة القلب الألمانية (F / 01/12). وأيد فرانك ويخورست من قبل برنامج أبحاث الاتحاد الأوروبي FP7 "Nanomag" FP7-NMP-2013-الكبيرة-7.

Materials

PEI 25 kDa Sigma Aldrich 408727
EZ-Link Sulfo-NHS-LC-Biotin Thermo Scientific 21335
PD-10 Desalting Columns GE Healthcare 17085101 Containing Sephadex G-25 Medium
Ninhydrin Reagent solution 2% Sigma Aldrich 7285
Glycine Sigma Aldrich 410225
Pierce Biotin Quantitation Kit Thermo Scientific 28005
 Microplate reader Model 680 Bio-Rad
Streptavidin MagneSphere Paramagnetic Particles Promega Z5481
Millex-HV PVDF Filter Merck SLHV013SL 0.45µm
Libra 120 transmission electron microscope  Zeiss Acceleration Voltage 120KV
Sapphire X-ray detector EDAX-Amatek
Cell culture plastic TPP
NHS-Esther Atto 565 ATTO-TEC GmbH AD 565-31
NHS-Esther Atto 488  ATTO-TEC GmbH AD 488-31
Cy5 miRNA Label IT kit Mirus Bio MIR 9650
Biotin Atto 565 ATTO-TEC GmbH AD 565-71
Collagense Type IV Gibco Thermo Scientific 17104019
Endothelial growth medium, EGM-2 Lonza CC-3156 & CC-4176
Penicillin/Streptomycin Thermo Scientific 15140122 100 U/ml, 100µg/ml
Matrigel BD Biosciences 356234
anti-PECAM-1 antibody Santa Cruz sc-1506
MS MACS columns Miltenyi Biotec  130-042-201
Near-IR Live/Dead Cell Stain Kit Thermo Scientific L10119
Cy3 Dye-Labeled Pre-miR Negative Control Thermo Scientific AM17120 "Cy3-miR" or "Cyanine-miR3" in the manuscript
Pre-miR miRNA Precursor Molecules – Negative Control  Thermo Scientific AM17110 "scr-miR" in the manuscript
Anti-hsa-miR92a-3p synthetic Inhibitor  Thermo Scientific AM10916
LSM 780 ELYRA PS.1 system Zeiss
Paraformaldehyde Sigma Aldrich 158127 4% solution in PBS
DAPI nuclear stain Thermo Scientific D1306
NucleoSpin RNA isolation Kit Machery-Nagel 740955
mirVana miRNA Isolation Kit Thermo Scientific AM1560
TaqMan MicroRNA Reverse Transcription Kit Thermo Scientific 4366596
StepOnePlus Real-Time PCR System Applied Biosystems
High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814
hsa-miR-92a TaqMan assay Thermo Scientific 000431 Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU
FastGene Taq Ready Mix Nippon Genetics LS27
ITGA5 TaqMan assay Thermo Scientific Hs01547673_m1
RNU6B TaqMan assay Thermo Scientific 001093
18S rRNA Endogenous Control Thermo Scientific 4333760F
Gelatin Sigma Aldrich G7041
CellTrace Calcein Red-Orange Thermo Scientific C34851
PBS Pan Biotech P04-53500
BSA Sigma Aldrich
MACS buffer Miltenyi Biotec  130-091-221
Agarose Sigma Aldrich A9539
7.1 Tesla animal MRI system Bruker Corporation A7906
ImageJ software National Institutes of Health upgraded with an AngiogenesisAnalyzer (NIH)
MPS device Bruker Biospin
Matlab software Mathworks
Ring Neodym Magnet  magnets4you GmbH RM-10x04x05-G ø 10 mm; remanescence is ~1.3T, coercivity ≥ 955 kA/m
Click-iT EdU Alexa Fluor 647 Imaging Kit Thermo Scientific C10340
FluorSave Reagent Merck 345789
Ultrasonic bath Bandelin electronic Type: RK 100 SH
DOWNLOAD MATERIALS LIST

Referencias

  1. Behfar, A., Crespo-Diaz, R., Terzic, A., Gersh, B. J. Cell therapy for cardiac repair-lessons from clinical trials. Nat Rev Cardiol. 11 (4), 232-246 (2014).
  2. Zeng, L., Hu, Q., et al. Bioenergetic and functional consequences of bone marrow-derived multipotent progenitor cell transplantation in hearts with postinfarction left ventricular remodeling. Circulation. 115 (14), 1866-1875 (2007).
  3. Dib, N., Khawaja, H., Varner, S., McCarthy, M., Campbell, A. Cell therapy for cardiovascular disease: a comparison of methods of delivery. J Cardiovasc Transl Res. 4 (2), 177-181 (2011).
  4. Terrovitis, J., Lautamäki, R., et al. Noninvasive Quantification and Optimization of Acute Cell Retention by In Vivo Positron Emission Tomography After Intramyocardial Cardiac-Derived Stem Cell Delivery. J Am Coll Cardiol. 54 (17), 1619-1626 (2009).
  5. Villate-Beitia, I., Puras, G., Zarate, J., Agirre, M., Ojeda, E., Pedraz, J. L. First Insights into Non-invasive Administration Routes for Non-viral Gene Therapy. Gene Therapy – Principles and Challenges. , (2015).
  6. Nayerossadat, N., Maedeh, T., Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 1, 27 (2012).
  7. Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R., Anderson, D. G. Non-viral vectors for gene-based therapy. Nat Rev Genet. 15 (8), 541-555 (2014).
  8. Chira, S., Jackson, C. S., et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget. 6 (31), 30675-30703 (2015).
  9. Li, W., Ma, N., et al. Enhanced thoracic gene delivery by magnetic nanobead-mediated vector. J Gene Med. 10 (8), 897-909 (2008).
  10. Muthana, M., Kennerley, A. J., et al. Use of magnetic resonance targeting to direct cell therapy to target sites in vivo. Nat Commun. 6, 1-11 (2013).
  11. Zheng, B., von See, M. P., et al. Quantitative Magnetic Particle Imaging Monitors the Transplantation, Biodistribution, and Clearance of Stem Cells In Vivo. Theranostics. 6 (3), 291-301 (2016).
  12. Almstätter, I., Mykhaylyk, O., et al. Characterization of magnetic viral complexes for targeted delivery in oncology. Theranostics. 5 (7), 667-685 (2015).
  13. Juliano, R. L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. , (2016).
  14. Chen, J., Guo, Z., Tian, H., Chen, X. Production and clinical development of nanoparticles for gene delivery. Mol Ther Methods Clin Dev. 3, 16023 (2016).
  15. Schade, A., Delyagina, E., et al. Innovative strategy for microRNA delivery in human mesenchymal stem cells via magnetic nanoparticles. Int J Mol Sci. 14 (6), 10710-10726 (2013).
  16. Delyagina, E., Schade, A., et al. Improved transfection in human mesenchymal stem cells: effective intracellular release of pDNA by magnetic polyplexes. Nanomedicine. 9 (7), 999-1017 (2014).
  17. Voronina, N., Lemcke, H., et al. Non-viral magnetic engineering of endothelial cells with microRNA and plasmid-DNA-An optimized targeting approach. Nanomedicine. 12 (8), 2353-2364 (2016).
  18. Hunt, M. A., Currie, M. J., Robinson, B. A., Dachs, G. U. Optimizing transfection of primary human umbilical vein endothelial cells using commercially available chemical transfection reagents. J Biomol Tech. 21 (2), 66-72 (2010).
  19. Zhang, J., Wang, Z., Lin, W., Chen, S. Gene transfection in complex media using PCBMAEE-PCBMA copolymer with both hydrolytic and zwitterionic blocks. Biomaterials. 35 (27), 7909-7918 (2014).
  20. Lim, J., Dobson, J. Improved transfection of HUVEC and MEF cells using DNA complexes with magnetic nanoparticles in an oscillating field. J Genet. 91 (2), 223-227 (2012).
  21. Moore, S., Stein, W. H. A modified ninhydrin reagent for the photometric determination of amino acids and related compounds. J Biol Chem. 211 (2), 907-913 (1954).
  22. Jones, D. L., Owen, A. G., Farrar, J. F. Simple method to enable the high resolution determination of total free amino acids in soil solutions and soil extracts. Soil Biol Biochem. 34 (12), 1893-1902 (2002).
  23. Kircheis, R., Wightman, L., et al. Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8 (1), 28-40 (2001).
  24. Green, N. M. A SPECTROPHOTOMETRIC ASSAY FOR AVIDIN AND BIOTIN BASED ON BINDING OF DYES BY AVIDIN. Biochem J. 94, 23 (1965).
  25. Haugland, R. P., You, W. W. Coupling of Antibodies with Biotin. Methods Mol Biol. 418, 13-23 (2008).
  26. Braunschweig, J., Bosch, J., Heister, K., Kuebeck, C., Meckenstock, R. U. Reevaluation of colorimetric iron determination methods commonly used in geomicrobiology. J Microbiol Methods. 89 (1), 41-48 (2012).
  27. Andrade, &. #. 1. 9. 4. ;. L., Valente, M. A., Ferreira, J. M. F., Fabris, J. D. Preparation of size-controlled nanoparticles of magnetite. J Magn Magn Mater. 324 (10), 1753-1757 (2012).
  28. Barbaro, D., Di Bari, L., et al. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter. PLoS ONE. 10 (4), e0123159 (2015).
  29. Gaebel, R., Ma, N., et al. Patterning human stem cells and endothelial cells with laser printing for cardiac regeneration. Biomaterials. 32 (35), 9218-9230 (2011).
  30. Martín de Llano, J. J., Fuertes, G., Torró, I., García Vicent, C., Fayos, J. L., Lurbe, E. Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels. J Transl Med. 7, 30 (2009).
  31. Bonauer, A., Carmona, G., et al. MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 324 (5935), 1710-1713 (2009).
  32. Wang, W., Li, W., et al. Polyethylenimine-mediated gene delivery into human bone marrow mesenchymal stem cells from patients. J Cell Mol Med. 15 (9), 1989-1998 (2011).
  33. Lemcke, H., Peukert, J., Voronina, N., Skorska, A., Steinhoff, G., David, R. Applying 3D-FRAP microscopy to analyse gap junction-dependent shuttling of small antisense RNAs between cardiomyocytes. J Mol Cell Cardiol. 98, 117-127 (2016).
  34. Cheng, K., Li, T. -. S., Malliaras, K., Davis, D. R., Zhang, Y., Marbán, E. Magnetic targeting enhances engraftment and functional benefit of iron-labeled cardiosphere-derived cells in myocardial infarction. Circ Res. 106 (10), 1570-1581 (2010).
  35. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr Protoc Immunol. , A.3B.1-A.3B.2 (2001).
  36. Chorny, M., Alferiev, I. S., et al. Formulation and in vitro characterization of composite biodegradable magnetic nanoparticles for magnetically guided cell delivery. Pharm Res. 29 (5), 1232-1241 (2012).
  37. Poller, W., Löwa, N., et al. Magnetic Particle Spectroscopy Reveals Dynamic Changes in the Magnetic Behavior of Very Small Superparamagnetic Iron Oxide Nanoparticles During Cellular Uptake and Enables Determination of Cell-Labeling Efficacy. J Biomed Nanotechnol. 12 (2), 337-346 (2016).
  38. Lobsien, D., Dreyer, A. Y., Stroh, A., Boltze, J., Hoffmann, K. T. Imaging of VSOP Labeled Stem Cells in Agarose Phantoms with Susceptibility Weighted and T2* Weighted MR Imaging at 3T: Determination of the Detection Limit. PLoS ONE. 8 (5), 1-10 (2013).
  39. Hernando, D., Kühn, J. -. P., et al. R2* estimation using "in-phase" echoes in the presence of fat: the effects of complex spectrum of fat. J Magn Reson Imaging. 37 (3), 717-726 (2013).
  40. Soenen, S. J., Rivera-Gil, P., Montenegro, J. -. M., Parak, W. J., De Smedt, S. C., Braeckmans, K. Cellular toxicity of inorganic nanoparticles: Common aspects and guidelines for improved nanotoxicity evaluation. Nano Today. 6 (5), 446-465 (2011).
  41. Robert, D., Kirkton, N. B. Genetic Engineering and Stem Cells: Combinatorial Approaches for Cardiac Cell Therapy. IEEE Eng Med Biol Mag. 27 (3), 85 (2008).
  42. Chen, Y., Wang, W., et al. Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer. Int J Nanomedicine. 7, 359-368 (2012).
  43. Diener, Y., Jurk, M., et al. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells. Sci Rep. 5, 17184 (2015).
  44. Müller, P., Voronina, N., et al. Magnet-Bead Based MicroRNA Delivery System to Modify CD133+ Stem Cells. Stem Cells Int. 2016, 1-16 (2016).
  45. Yang, H., Vonk, L. A., et al. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur J Pharm Sci. 53, 35-44 (2014).
  46. Chen, C. -. H., Sereti, K. -. I., Wu, B. M., Ardehali, R. Translational aspects of cardiac cell therapy. J Cell Mol Med. 19 (8), 1757-1772 (2015).
  47. Alaiti, M. A., Ishikawa, M., et al. Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell-mediated angiogenesis. J Cell Mol Med. 16 (10), 2413-2421 (2012).
  48. Landázuri, N., Tong, S., et al. Magnetic targeting of human mesenchymal stem cells with internalized superparamagnetic iron oxide nanoparticles. Small. 9 (23), 4017-4026 (2013).
  49. Carenza, E., Barceló, V., et al. In vitro angiogenic performance and in vivo brain targeting of magnetized endothelial progenitor cells for neurorepair therapies. Nanomedicine. 10 (1), 225-234 (2014).
  50. Kyrtatos, P. G., Lehtolainen, P., et al. Magnetic Tagging Increases Delivery of Circulating Progenitors in Vascular Injury. JACC Cardiovasc Interv. 2 (8), 794-802 (2009).
  51. Huang, Z., Shen, Y., et al. Magnetic targeting enhances retrograde cell retention in a rat model of myocardial infarction. Stem Cell Res Ther. 4 (6), 149 (2013).
  52. Wu, X., Tan, Y., Mao, H., Zhang, M. Toxic effects of iron oxide nanoparticles on human umbilical vein endothelial cells. Int J Nanomedicine. 5, 385-399 (2010).
  53. Soenen, S. J. H., Nuytten, N., De Meyer, S. F., De Smedt, S. C., De Cuyper, M. High Intracellular Iron Oxide Nanoparticle Concentrations Affect Cellular Cytoskeleton and Focal Adhesion Kinase-Mediated Signaling. Small. 6 (7), 832-842 (2010).
  54. Cheng, K., Malliaras, K., et al. Magnetic enhancement of cell retention, engraftment, and functional benefit after intracoronary delivery of cardiac-derived stem cells in a rat model of ischemia/reperfusion. Cell Transplant. 21 (6), 1121-1135 (2012).
  55. Vandergriff, A. C., Hensley, T. M., et al. Magnetic targeting of cardiosphere-derived stem cells with ferumoxytol nanoparticles for treating rats with myocardial infarction. Biomaterials. 35 (30), 8528-8539 (2014).

Tags

Keywords: Magnetized CellsMiR-modified CellsEndothelial CellsCell MagnetizationMicroRNA TransfectionPolyethyleneimeneSuper Paramagnetic Iron Oxide NanoparticlesCell TherapyRegenerative MedicineCell RetentionCell SurvivalConfocal MicroscopyStructured Illumination Microscopy
check_url/es/55567?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citar este artículo
Voronina, N., Lemcke, H., Wiekhorst, F., Kühn, J., Frank, M., Steinhoff, G., David, R. Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells. J. Vis. Exp. (123), e55567, doi:10.3791/55567 (2017).
Descargar cita
Reimpresiones y permisos

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image